Order Kazusa clone(s) from : ![]() |
Product ID | ORK00563 |
---|---|
Accession No | AB011130 |
Description | calcium channel, voltage-dependent, alpha 2/delta subunit 2, transcript variant 1 |
Clone name | hh01485 |
Vector information | |
cDNA sequence | DNA sequence (5303 bp) Predicted protein sequence (1145 aa) |
HaloTag ORF Clone |
FHC00563
![]() |
Flexi ORF Clone | FXC00563 |
Source | Human adult brain |
Rouge ID |
mKIAA0558
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1864 bp |
---|---|
Genome contig ID | gi89161205r_50275237 |
PolyA signal sequence (ATTAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 50375237 | 50515859 | 38 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013608 | 141 | 265 | PF08399 | VWA N-terminal |
IPR002035 | 291 | 469 | PF00092 | von Willebrand factor | |
IPR004010 | 485 | 574 | PF02743 | Cache | |
IPR013680 | 580 | 666 | PF08473 | Voltage-dependent calcium channel | |
HMMSmart | IPR002035 | 289 | 464 | SM00327 | von Willebrand factor |
ProfileScan | IPR002035 | 291 | 469 | PS50234 | von Willebrand factor |
![]() |
---|
Primer_f | TTACAAGGAATCACACACACG |
---|---|
Primer_r | GCCATTTCCTTTTCTCTGCCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTACAAGGAATCACACACACG |
Primer_r | GCCATTTCCTTTTCTCTGCCC |
PCR product length | 120 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |