KIAA0579

Product ID	ORK07407
Accession No	AB011151
Description	zinc finger, CCHC domain containing 14
Clone name	bg00015
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6769 bp) Predicted protein sequence (910 aa)
Source	Human adult brain
Rouge ID	mKIAA0579 by Kazusa Mouse cDNA Project
Note	We replaced hj00453, former representative clones for KIAA0579 with bg00015. (2002/5/10)

Length: 6769 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4034 bp
Genome contig ID	gi51511732r_85897378
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAATGTACTGAAAATAAAAATTTTAAAAAAGAAC
Flanking genome sequence (99977 - 99928)	----+--------+--------+--------+--------+----* TGTTTTATTTCACTAGGTCTTTGTCTCAGAATATGAAGCACACACCTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	85997355	86082819	13	99.2	Perfect prediction

Length: 910 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8WYQ9	100.0	Zinc finger CCH...	Homo sapiens
BAF82371	99.9	unnamed protein...	Homo sapiens
AAI01479	99.9	Zinc finger, CC...	Homo sapiens
XP_001092159	99.2	similar to zinc...	Macaca mulatta
EAW95388	99.7	zinc finger, CC...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051531	5.8e-11	26.6	KIAA1744

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001878	867	876	PR00939	Zinc finger
FPrintScan	IPR001878	876	884	PR00939	Zinc finger
HMMPfam	IPR001660	255	316	PF00536	Sterile alpha motif SAM
HMMPfam	IPR001878	867	884	PF00098	Zinc finger
HMMSmart	IPR001878	868	884	SM00343	Zinc finger
ProfileScan	IPR001878	869	884	PS50158	Zinc finger

Primer_f	AAGGTTAACATTGCTCCACTG
Primer_r	GTCCAATAGAAGCTGTGAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGGTTAACATTGCTCCACTG
Primer_r	GTCCAATAGAAGCTGTGAAGG
PCR product length	179 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles