Gene/Protein Characteristic Table for KIAA0584
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00102
Accession No AB011156
Description collagen beta(1-O)galactosyltransferase 2, transcript variant 1
Clone name hj00933
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5144 bp)
Predicted protein sequence (738 aa)
Flexi ORF Clone FXC00102
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 5144 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 738 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_524994 0 99.3 glycosyltransfe...
Pan troglodytes
Q8IYK4 0 100.0 Glycosyltransfe...
Homo sapiens
XP_222718 2e-206 89.9 similar to glyc...
Rattus norvegicus
XP_001788446 4.8e-206 94.1 similar to glyc...
Bos taurus
EDM09562 4.9e-205 93.8 glycosyltransfe...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040935 4e-61 54.4 KIAA1502
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002654 453 638 PF01755 Glycosyl transferase
ScanRegExp IPR000886 735 738 PS00014 Endoplasmic reticulum targeting sequence
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ACAACCGTGACATCAGCAGTG
Primer_r CACTCTGAAATAGCACGCAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f ACAACCGTGACATCAGCAGTG
Primer_r CACTCTGAAATAGCACGCAAG
PCR product length 182 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp