KIAA0609

Product ID	ORK00107
Accession No	AB011181
Description	like-glycosyltransferase
Clone name	hk00807
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3884 bp) Predicted protein sequence (769 aa)
HaloTag ORF Clone	FHC00107
Flexi ORF Clone	FXC00107
Source	Human adult brain
Rouge ID	mKIAA0609 by Kazusa Mouse cDNA Project
Note	We replaced hh00979b, former representative clones for KIAA0609 with hk00807. (2000/1/08)

Length: 3884 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1338 bp
Genome contig ID	gi89161203r_31899075
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGCGAAAGCTGCATTTAATAAATGAAAGTACAGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTTTCTTCCCCATTCCCCTCCCACTCTTGCAGGAAGCTACTGAGACACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	31999075	32646331	14	99.9	Perfect prediction

Length: 769 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11217	0	100.0	glycosyltransfe...	synthetic construct
BAH11875	0	86.5	unnamed protein...	Homo sapiens
XP_531751	6.1e-165	89.8	similar to like...	Canis lupus fam...
O95461	4.3e-160	93.1	Glycosyltransfe...	Homo sapiens
XP_001112944	8e-160	93.0	similar to like...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002495	205	481	PF01501	Glycosyl transferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	76	FLAASLSLLCIPAITWIYLFSGS	98	PRIMARY	23

Primer_f	CAACCACCTTCACCTTCACAC
Primer_r	AATACAAACAGCCCAGCAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAACCACCTTCACCTTCACAC
Primer_r	AATACAAACAGCCCAGCAGAG
PCR product length	108 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles