Order Kazusa clone(s) from : ![]() |
Product ID | ORK05613 |
---|---|
Accession No | AB014518 |
Description | POM121 transmembrane nucleoporin |
Clone name | hg03971 |
Vector information | |
cDNA sequence | DNA sequence (7011 bp) Predicted protein sequence (1052 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0618
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2970 bp |
---|---|
Genome contig ID | gi89161213f_71887872 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (172045 - 172094) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 71987872 | 72059915 | 16 | 99.2 | Perfect prediction |
| 7 | r | 74880858 | 74995379 | 18 | 97.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
![]() |
Primer_f | CCGACCCATGCAGAAATAGGC |
---|---|
Primer_r | CCTTCTGCCCTACCATGTTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCGACCCATGCAGAAATAGGC |
Primer_r | CCTTCTGCCCTACCATGTTGC |
PCR product length | 141 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |