KIAA0618

Product ID	ORK05613
Accession No	AB014518
Description	POM121 transmembrane nucleoporin
Clone name	hg03971
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7011 bp) Predicted protein sequence (1052 aa)
Source	Human adult brain
Rouge ID	mKIAA0618 by Kazusa Mouse cDNA Project

Length: 7011 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2970 bp
Genome contig ID	gi89161213f_71887872
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GCAGGACATGCCTTGTTAATAAAACGTTTACAAGC
Flanking genome sequence (172045 - 172094)	----+--------+--------+--------+--------+----* AGTATGCTTGGTAAAAGTCTTCGCCGTTCTCTAGTCTCAATAAACCAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	71987872	72059915	16	99.2	Perfect prediction
Ensembl gnome browser	7	r	74880858	74995379	18	97.4	Perfect prediction

Length: 1052 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96HA1	99.9	Nuclear envelop...	Homo sapiens
A8CG34	97.1	Nuclear envelop...	Homo sapiens
AAH08794	99.9	POM121 membrane...	Homo sapiens
BAF85237	99.7	unnamed protein...	Homo sapiens
XP_001110260	93.2	nuclear pore me...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D14689	5.5e-06	26.1	KIAA0023
AB029037	0.00073	27.8	KIAA1114
AB051468	0.00082	23.9	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CCGACCCATGCAGAAATAGGC
Primer_r	CCTTCTGCCCTACCATGTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCGACCCATGCAGAAATAGGC
Primer_r	CCTTCTGCCCTACCATGTTGC
PCR product length	141 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles