Gene/Protein Characteristic Table for KIAA0627
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07720
Accession No AB014527
Description cytoplasmic linker associated protein 2, transcript variant 2
Clone name hh01026s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5614 bp)
Predicted protein sequence (1324 aa)
Flexi ORF Clone FXC07720
Source Human adult brain
Rouge ID mKIAA0627 by Kazusa Mouse cDNA Project
Note We replaced hh01026, former representative clones for KIAA0627 with hh01026s2. (2008/8/27)
Features of the cloned cDNA sequence
Description

Length: 5614 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 1324 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75122 0 99.9 CLIP-associatin...
Homo sapiens
XP_001169232 0 99.2 CLIP-associatin...
Pan troglodytes
XP_534211 0 98.5 similar to CLIP...
Canis lupus fam...
XP_609911 0 98.6 similar to CLIP...
Bos taurus
XP_857427 0 98.4 similar to CLIP...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014522 2e-74 67.9 KIAA0622
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 1127 1163 PF02985 HEAT
IPR000357 1245 1281 PF02985 HEAT
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GCACAACAGTAAGCATAGAAC
Primer_r GATTTGTCATAGGCTTTCCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f GCACAACAGTAAGCATAGAAC
Primer_r GATTTGTCATAGGCTTTCCCC
PCR product length 140 bp
PCR conditions 95 °C15 sec60 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp