Gene/Protein Characteristic Table for KIAA0633
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01108
Accession No AB014533
Description cordon-bleu WH2 repeat protein, transcript variant 2
Clone name hj02892
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5289 bp)
Predicted protein sequence (1316 aa)
Flexi ORF Clone FXC01108
Source Human adult brain
Rouge ID mKIAA0633 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5289 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1316 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75128 0 100.0 Protein cordon-...
Homo sapiens
EAL23896 0 99.8 cordon-bleu hom...
Homo sapiens
XP_519099 0 98.4 similar to cord...
Pan troglodytes
AAI44100 0 96.0 Unknown (protei...
Homo sapiens
AAH45771 0 92.5 COBL protein [H...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023194 1.2e-16 26.5 KIAA0977
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003124 1164 1184 PF02205 Actin-binding WH2
IPR003124 1204 1224 PF02205 Actin-binding WH2
IPR003124 1292 1312 PF02205 Actin-binding WH2
HMMSmart IPR003124 1164 1184 SM00246 Actin-binding WH2
IPR003124 1204 1224 SM00246 Actin-binding WH2
IPR003124 1292 1312 SM00246 Actin-binding WH2
ProfileScan IPR003124 1164 1184 PS51082 Actin-binding WH2
IPR003124 1204 1224 PS51082 Actin-binding WH2
IPR003124 1292 1312 PS51082 Actin-binding WH2
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f CACCCAGAAAACAGTCCTACG
Primer_r GTCATCAGGCTCCGTACACAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name GeneBridge 4
Primer_f CACCCAGAAAACAGTCCTACG
Primer_r GTCATCAGGCTCCGTACACAG
PCR product length 184 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp