Order Kazusa clone(s) from : ![]() |
Product ID | ORK01108 |
---|---|
Accession No | AB014533 |
Description | cordon-bleu WH2 repeat protein, transcript variant 2 |
Clone name | hj02892 |
Vector information | |
cDNA sequence | DNA sequence (5289 bp) Predicted protein sequence (1316 aa) |
HaloTag ORF Clone |
FHC01108
![]() |
Flexi ORF Clone | FXC01108 |
Source | Human adult brain |
Rouge ID |
mKIAA0633
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003124 | 1164 | 1184 | PF02205 | Actin-binding WH2 |
IPR003124 | 1204 | 1224 | PF02205 | Actin-binding WH2 | |
IPR003124 | 1292 | 1312 | PF02205 | Actin-binding WH2 | |
HMMSmart | IPR003124 | 1164 | 1184 | SM00246 | Actin-binding WH2 |
IPR003124 | 1204 | 1224 | SM00246 | Actin-binding WH2 | |
IPR003124 | 1292 | 1312 | SM00246 | Actin-binding WH2 | |
ProfileScan | IPR003124 | 1164 | 1184 | PS51082 | Actin-binding WH2 |
IPR003124 | 1204 | 1224 | PS51082 | Actin-binding WH2 | |
IPR003124 | 1292 | 1312 | PS51082 | Actin-binding WH2 |
![]() |
---|
![]() |
Primer_f | CACCCAGAAAACAGTCCTACG |
---|---|
Primer_r | GTCATCAGGCTCCGTACACAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CACCCAGAAAACAGTCCTACG |
Primer_r | GTCATCAGGCTCCGTACACAG |
PCR product length | 184 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |