KIAA0977

Product ID	ORK00706
Accession No	AB023194
Description	cordon-bleu WH2 repeat protein-like 1, transcript variant 2
Clone name	hj07018
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj07018 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4834 bp) Predicted protein sequence (1207 aa)
HaloTag ORF Clone	FHC00706
Flexi ORF Clone	FXC00706
Source	Human adult brain
Rouge ID	mKIAA0977 by Kazusa Mouse cDNA Project

Length: 4834 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1117 bp
Genome contig ID	gi89161199r_165149585
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TGTTCAAACAAGATGATATTAAATTTGTTTTCACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTACTGGGATATCTGCCTCTTGGGGATTTTTTTTTCAATTTAATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	165249585	165406168	14	100.0	Perfect prediction

Length: 1207 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q53SF7	99.2	Cordon-bleu pro...	Homo sapiens
AAX93068	100.0	unknown [Homo s...	Homo sapiens
EAX11339	99.9	COBL-like 1, is...	Homo sapiens
XP_001098489	95.0	similar to COBL...	Macaca mulatta
BAH11931	97.4	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014533	1.6e-18	26.7	KIAA0633

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	1160	1180	PF02205	Actin-binding WH2
ProfileScan	IPR003124	1160	1180	PS51082	Actin-binding WH2

Primer_f	TAACATTCCAAAGCTCTGACC
Primer_r	TCTGAAGTGGAAGTGAAGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-