KIAA0645

Gene/Protein Characteristic Table for KIAA0645

Order Kazusa clone(s) from :

Product ID	ORK00588
Accession No	AB014545
Description	DEP domain containing 5, transcript variant 1
Clone name	hj03630
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5292 bp) Predicted protein sequence (1578 aa)
HaloTag ORF Clone	FHC00588
Flexi ORF Clone	FXC00588
Source	Human adult brain
Rouge ID	mKIAA0645 by Kazusa Mouse cDNA Project

Length: 5292 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Features of the protein sequence

Description

Length: 1578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75140	100.0	DEP domain-cont...	Homo sapiens
ACE77702	96.0	DEP domain cont...	Sorex araneus
XP_001928021	95.7	similar to DEPD...	Sus scrofa
EDL37406	94.7	DEP domain cont...	Mus musculus
EDM00137	94.2	DEP domain cont...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000591	1162	1235	PF00610	Pleckstrin/ G-protein
HMMSmart	IPR000591	1162	1237	SM00049	Pleckstrin/ G-protein
ProfileScan	IPR000591	1162	1237	PS50186	Pleckstrin/ G-protein

Expression profile

Description

RT-PCR

RT-PCR-ELISA

Experimental conditions

Primer_f	CCCCCACGACAAGTCTTCTAC
Primer_r	GGTGAAGGAAAAGGATGCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 22

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CCCCCACGACAAGTCTTCTAC
Primer_r	GGTGAAGGAAAAGGATGCTAC
PCR product length	203 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp