Gene/Protein Characteristic Table for KIAA0667
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04431
Accession No AB014567
Description cullin-associated and neddylation-dissociated 2 (putative)
Clone name hk02319
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4157 bp)
Predicted protein sequence (1111 aa)
Source Human adult brain
Rouge ID mKIAA0667 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4157 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1111 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75155 0 100.0 Cullin-associat...
Homo sapiens
EAW64143 0 99.7 hCG28318, isofo...
Homo sapiens
XP_001155917 0 99.4 TBP-interacting...
Pan troglodytes
XP_001084646 0 97.7 TBP-interacting...
Macaca mulatta
XP_859157 0 95.1 similar to Cull...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB020636 1.2e-167 55.2 KIAA0829
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 73 105 PF02985 HEAT
IPR000357 152 188 PF02985 HEAT
IPR000357 415 451 PF02985 HEAT
IPR000357 755 791 PF02985 HEAT
IPR013932 919 1085 PF08623 TATA-binding protein interacting (TIP20)
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CATAGTCTGTCTGGTTCCTTC
Primer_r GAGCACTAACTTCAGGCATTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f CATAGTCTGTCTGGTTCCTTC
Primer_r GAGCACTAACTTCAGGCATTG
PCR product length 152 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp