Order Kazusa clone(s) from : ![]() |
Product ID | ORK01125 |
---|---|
Accession No | AB020636 |
Description | cullin-associated and neddylation-dissociated 1 |
Clone name | hh04834s1 |
Vector information | |
cDNA sequence | DNA sequence (5813 bp) Predicted protein sequence (1277 aa) |
HaloTag ORF Clone |
FHC01125
![]() |
Flexi ORF Clone | FXC01125 |
Source | Human adult brain |
Rouge ID |
mKIAA0829
by Kazusa Mouse cDNA Project
|
Note | We replaced hh04834, former representative clones for KIAA0829 with hh04834s1. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1781 bp |
---|---|
Genome contig ID | gi89161190f_65849426 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (145234 - 145283) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 65949426 | 65994658 | 15 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TCTCAGTTACCCATTTGTGTG |
---|---|
Primer_r | AAACCTGTGATAGCTGGCTTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |