KIAA0674

Gene/Protein Characteristic Table for KIAA0674

Order Kazusa clone(s) from :

Product ID	ORK01110
Accession No	AB014574
Description	FK506 binding protein 15, 133kDa
Clone name	hk02519
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4263 bp) Predicted protein sequence (1234 aa)
HaloTag ORF Clone	FHC01110
Flexi ORF Clone	FXC01110
Source	Human adult brain
Rouge ID	mKIAA0674 by Kazusa Mouse cDNA Project

Length: 4263 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Features of the protein sequence

Description

Length: 1234 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI10964	99.9	FK506 binding p...	Homo sapiens
EAW87356	100.0	hCG29188 [Homo ...	Homo sapiens
Q5T1M5	99.9	FK506-binding p...	Homo sapiens
XP_001098655	96.3	similar to Golg...	Macaca mulatta
NP_001125078	96.9	FK506 binding p...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	652	794	PD138041	NULL
HMMPfam	IPR001179	204	302	PF00254	Peptidyl-prolyl cis-trans isomerase
ProfileScan	IPR001179	212	305	PS50059	Peptidyl-prolyl cis-trans isomerase

Expression profile

Description

RT-PCR

RT-PCR-ELISA

Experimental conditions

Primer_f	TCACCTGTAAGAGTCCTGTCC
Primer_r	ACTGCACTGGGATTTAGATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 9

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TCACCTGTAAGAGTCCTGTCC
Primer_r	ACTGCACTGGGATTTAGATGG
PCR product length	179 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp