KIAA0675

Product ID	ORK01989
Accession No	AB014575
Description	DAZ interacting zinc finger protein 3
Clone name	hk02566
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4246 bp) Predicted protein sequence (1217 aa)
HaloTag ORF Clone	FHC01989
Flexi ORF Clone	FXC01989
Source	Human adult brain
Rouge ID	mKIAA0675 by Kazusa Mouse cDNA Project

Length: 4246 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	490 bp
Genome contig ID	gi89161205f_109704388
PolyA signal sequence (None)	+--------+--------+----*----+---- CACATGTACCCTAAAACTTAAAGTATAATAATAAT
Flanking genome sequence (188538 - 188587)	----+--------+--------+--------+--------+----* AAAAGAAAAAAAAAAGAAAGTAAAAAAAAAAAAAGAAGTGGATATTCACG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	109804388	109892924	32	100.0	Perfect prediction

Length: 1217 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q86Y13	100.0	E3 ubiquitin-pr...	Homo sapiens
XP_001151742	98.9	zinc finger DAZ...	Pan troglodytes
XP_001503296	92.4	similar to E3 u...	Equus caballus
XP_535732	91.0	similar to Ubiq...	Canis lupus fam...
NP_001103487	83.2	DAZ interacting...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	1157	1196	PF00097	Zinc finger
HMMSmart	IPR001841	1157	1196	SM00184	Zinc finger
ProfileScan	IPR001841	1157	1197	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	136	HQINIGYYLTLLFLYGVALTE	156	PRIMARY	21

Primer_f	CAGACTCCACGTTTTGCTACC
Primer_r	TACACCACTCAAACAAGCAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAGACTCCACGTTTTGCTACC
Primer_r	TACACCACTCAAACAAGCAGC
PCR product length	139 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles