KIAA0694

Product ID	ORK00608
Accession No	AB014594
Description	dedicator of cytokinesis 10
Clone name	hk03987s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4008 bp) Predicted protein sequence (595 aa)
HaloTag ORF Clone	FHC00608
Flexi ORF Clone	FXC00608
Source	Human adult brain
Rouge ID	mKIAA0694 by Kazusa Mouse cDNA Project
Note	We replaced hk03987, former representative clones for KIAA0694 with hk03987s1. (2002/5/10)

Length: 4008 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1987 bp
Genome contig ID	gi89161199r_225333842
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAGAGTGAGACCCTGTCTCT
Flanking genome sequence (99699 - 99650)	----+--------+--------+--------+--------+----* AAAAAAAAGAAAAAAAAAACGCTCTATCCTTTATTAGCCAAGTGAGCTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	225433541	225615574	14	99.4	Perfect prediction

Length: 595 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW70832	100.0	dedicator of cy...	Homo sapiens
Q96BY6	100.0	Dedicator of cy...	Homo sapiens
EAW70834	99.8	dedicator of cy...	Homo sapiens
EAW70835	99.8	dedicator of cy...	Homo sapiens
NP_055504	99.8	dedicator of cy...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028981	1.6e-25	47.2	KIAA1058

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	184	292	PF00169	Pleckstrin-like
HMMSmart	IPR001849	184	294	SM00233	Pleckstrin-like
ProfileScan	IPR001849	183	292	PS50003	Pleckstrin-like

Primer_f	AGGAACAACTAATGCCAGGAC
Primer_r	AGGGAACTGAGAATGCTTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGGAACAACTAATGCCAGGAC
Primer_r	AGGGAACTGAGAATGCTTAAC
PCR product length	168 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles