KIAA0700

Product ID	ORK01991
Accession No	AB014600
Description	SIN3 transcription regulator family member B, transcript variant 2
Clone name	fh14187
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh14187 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCA CGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5037 bp) Predicted protein sequence (1137 aa)
HaloTag ORF Clone	FHC01991
Flexi ORF Clone	FXC01991
Source	Human fetal brain
Rouge ID	mKIAA0700 by Kazusa Mouse cDNA Project
Note	We replaced hg01440, former representative clones for KIAA0700 with fh14187. (1999/2/06)

Length: 5037 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1623 bp
Genome contig ID	gi42406306f_16701211
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- TATTTGCACATTAAAGTTAATAATTGAATATTGAC
Flanking genome sequence (150952 - 151001)	----+--------+--------+--------+--------+----* ATCAAGCCGTGAGGGTGTGTTGGTCTTCCTGTGAGAGCCTTGCTGACTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	16801211	16852161	19	99.6	Perfect prediction

Length: 1137 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW84564	100.0	SIN3 homolog B,...	Homo sapiens
XP_852728	95.6	similar to SIN3...	Canis lupus fam...
XP_001915048	95.3	similar to SIN3...	Equus caballus
XP_001511618	88.5	similar to SIN3...	Ornithorhynchus...
AAI21316	73.1	SIN3 homolog B,...	Xenopus (Silura...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003822	66	112	PF02671	Paired amphipathic helix
	IPR003822	187	243	PF02671	Paired amphipathic helix
	IPR003822	328	374	PF02671	Paired amphipathic helix
	IPR013194	400	500	PF08295	Histone deacetylase interacting
HMMSmart	IPR013194	400	500	SM00761	Histone deacetylase interacting

Primer_f	GCCAAGAATCCCAAGTGACTG
Primer_r	TGGCAAGGGTGGCGGTTATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CATTCAAAACAGCTGCAAAGG
Primer_r	GGCACTTTGTACACACCCTGG
PCR product length	234 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles