KIAA0732

Product ID	ORK00120
Accession No	AB018275
Description	SMG6 nonsense mediated mRNA decay factor, transcript variant 1
Clone name	fg05988b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of SacI site to KpnI site of the vector.
cDNA sequence	DNA sequence (6002 bp) Predicted protein sequence (1449 aa)
HaloTag ORF Clone	FHC00120
Flexi ORF Clone	FXC00120
Source	Human fetal brain
Rouge ID	mKIAA0732 by Kazusa Mouse cDNA Project
Note	We replaced hk03717, former representative clones for KIAA0732 with fg05988b. (2001/5/29)

Length: 6002 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1650 bp
Genome contig ID	gi51511734r_1809888
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTGTTTCCTTAATAAATTTTTAGTTATGAAACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTGACCTCTTGCTGATCTGTTTCTGGGACTGGGGAGGGAGGCAGGTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	1909888	2153826	19	99.4	Terminal No-hit

Length: 1449 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW90558	99.9	hCG1813980, iso...	Homo sapiens
BAG11233	100.0	Smg-6 homolog, ...	synthetic construct
AAN46114	99.9	telomerase subu...	Homo sapiens
Q86US8	99.9	Telomerase-bind...	Homo sapiens
AAO17581	99.9	Est1p-like prot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87437	2.1e-08	24.1	KIAA0250
AB029012	7.2e-05	24.8	KIAA1089

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006596	1276	1427	SM00670	Nucleotide binding protein

Primer_f	TCTTCCCCTTCTAGTTGATCC
Primer_r	CTGTACTAGGTTCCTGCCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-