Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00477 |
---|---|
Accession No | D87437 |
Description | SMG7 nonsense mediated mRNA decay factor, transcript variant 2 |
Clone name | ha02790 |
Vector information | |
cDNA sequence | DNA sequence (5623 bp) Predicted protein sequence (1122 aa) |
HaloTag ORF Clone |
FHC00477
|
Flexi ORF Clone | FXC00477 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0250
by Kazusa Mouse cDNA Project
|
Note | We replaced ha02794, former representative clones for KIAA0250 with ha02790. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2253 bp |
---|---|
Genome contig ID | gi89161185f_181608285 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (181665 - 181714) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 181708285 | 181789948 | 22 | 99.5 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CTCCTATCTAAAGCCCCATTC |
Primer_r | CTGATAAAGATTCTCCTCCCC |
PCR product length | 126 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |