KIAA0250

Product ID	ORK00477
Accession No	D87437
Description	SMG7 nonsense mediated mRNA decay factor, transcript variant 2
Clone name	ha02790
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5623 bp) Predicted protein sequence (1122 aa)
HaloTag ORF Clone	FHC00477
Flexi ORF Clone	FXC00477
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0250 by Kazusa Mouse cDNA Project
Note	We replaced ha02794, former representative clones for KIAA0250 with ha02790. (2002/5/10)

Length: 5623 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2253 bp
Genome contig ID	gi89161185f_181608285
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GCTTTGCCTTTAATTAAACCATGTTCTCTCCAACC
Flanking genome sequence (181665 - 181714)	----+--------+--------+--------+--------+----* AGATCTGTGTATCGATTCTTTCTTTTCTATCCTAAAAGATATAAAAGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	181708285	181789948	22	99.5	Perfect prediction

Length: 1122 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09675	100.0	Smg-7 homolog, ...	synthetic construct
NP_963862	99.9	SMG-7 homolog i...	Homo sapiens
XP_001489684	97.8	Smg-7 homolog, ...	Equus caballus
XP_877580	96.2	similar to SMG-...	Bos taurus
NP_963863	99.9	SMG-7 homolog i...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018275	0.00051	24.1	KIAA0732

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTCCTATCTAAAGCCCCATTC
Primer_r	CTGATAAAGATTCTCCTCCCC
PCR product length	126 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles