Order Kazusa clone(s) from : ![]() |
Product ID | ORK01116 |
---|---|
Accession No | AB018282 |
Description | solute carrier family 4, sodium bicarbonate cotransporter, member 8 |
Clone name | hk03925 |
Vector information | |
cDNA sequence | DNA sequence (4079 bp) Predicted protein sequence (1130 aa) |
HaloTag ORF Clone |
FHC01116
![]() |
Flexi ORF Clone | FXC01116 |
Source | Human adult brain |
Rouge ID |
mKIAA0739
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 686 bp |
---|---|
Genome contig ID | gi89161190f_49971399 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (206518 - 206567) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 50071399 | 50177915 | 24 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR003024 | 232 | 238 | PR01232 | Na+/HCO3- transporter |
IPR003020 | 420 | 432 | PR01231 | HCO3- transporter | |
IPR003024 | 430 | 438 | PR01232 | Na+/HCO3- transporter | |
IPR003024 | 471 | 479 | PR01232 | Na+/HCO3- transporter | |
IPR003024 | 481 | 489 | PR01232 | Na+/HCO3- transporter | |
IPR003024 | 491 | 503 | PR01232 | Na+/HCO3- transporter | |
IPR003020 | 554 | 563 | PR01231 | HCO3- transporter | |
IPR003020 | 579 | 590 | PR01231 | HCO3- transporter | |
IPR003024 | 618 | 625 | PR01232 | Na+/HCO3- transporter | |
IPR003024 | 665 | 672 | PR01232 | Na+/HCO3- transporter | |
IPR003020 | 669 | 681 | PR01231 | HCO3- transporter | |
IPR003020 | 690 | 702 | PR01231 | HCO3- transporter | |
IPR003020 | 817 | 826 | PR01231 | HCO3- transporter | |
IPR003020 | 881 | 890 | PR01231 | HCO3- transporter | |
IPR003020 | 895 | 908 | PR01231 | HCO3- transporter | |
HMMPfam | IPR013769 | 231 | 490 | PF07565 | HCO3- transporter |
IPR011531 | 530 | 1044 | PF00955 | HCO3-transporter | |
HMMTigr | IPR003020 | 203 | 1119 | TIGR00834 | HCO3- transporter |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 563 | QCLASFLFLYCACMSPVITFGGL | 585 | PRIMARY | 23 | 2 | 604 | SMTGIAYSLFAGQALTILGSTGP | 626 | SECONDARY | 23 | 3 | 650 | ACIGLWTAFLCIVLVATDASSLV | 672 | PRIMARY | 23 | 4 | 680 | EEAFASLICIIFIYEAIEKLIHL | 702 | PRIMARY | 23 | 5 | 777 | TPDVLFWSCILFFTTFILSSTLK | 799 | SECONDARY | 23 | 6 | 816 | SDFAVFLTIFTMVIIDFLIGVPS | 838 | PRIMARY | 23 | 7 | 862 | GPNPWWTVIAAIIPALLCTILIF | 884 | PRIMARY | 23 | 8 | 913 | MVAIMLGVCSIMGLPWFVAATVL | 935 | PRIMARY | 23 | 9 | 974 | LMGCSVFMTAILKFIPMPVLYGV | 996 | PRIMARY | 23 | 10 | 1030 | LRHVPLRKVHLFTLIQLTCLVLL | 1052 | PRIMARY | 23 | 11 | 1059 | PAAIVFPMMVLALVFVRKVMDLC | 1081 | PRIMARY | 23 |
---|
![]() |
Primer_f | AGCACTTGGCATCTTGTCATC |
---|---|
Primer_r | CTCACTCATTTCTTGGTCTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGCACTTGGCATCTTGTCATC |
Primer_r | CTCACTCATTTCTTGGTCTGG |
PCR product length | 107 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |