Order Kazusa clone(s) from : ![]() |
Product ID | ORK05618 |
---|---|
Accession No | AB018289 |
Description | sel-1 suppressor of lin-12-like 3 (C. elegans), transcript variant 3 |
Clone name | hk04140 |
Vector information | |
cDNA sequence | DNA sequence (4086 bp) Predicted protein sequence (1029 aa) |
HaloTag ORF Clone |
FHC05618
![]() |
Flexi ORF Clone | FXC05618 |
Source | Human adult brain |
Rouge ID |
mKIAA0746
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006597 | 586 | 622 | PF08238 | Sel1-like |
IPR006597 | 624 | 659 | PF08238 | Sel1-like | |
IPR006597 | 660 | 692 | PF08238 | Sel1-like | |
IPR006597 | 693 | 731 | PF08238 | Sel1-like | |
IPR006597 | 844 | 880 | PF08238 | Sel1-like | |
HMMSmart | IPR006597 | 467 | 501 | SM00671 | Sel1-like |
IPR006597 | 503 | 539 | SM00671 | Sel1-like | |
IPR006597 | 586 | 622 | SM00671 | Sel1-like | |
IPR006597 | 624 | 659 | SM00671 | Sel1-like | |
IPR006597 | 660 | 692 | SM00671 | Sel1-like | |
IPR006597 | 693 | 731 | SM00671 | Sel1-like | |
IPR006597 | 732 | 769 | SM00671 | Sel1-like | |
IPR006597 | 844 | 880 | SM00671 | Sel1-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | LCSQPCVVNLEAVVSSEFRSSIP | 23 | SECONDARY | 23 | 2 | 945 | LHLRLLWGAILHSALIYFLGTFL | 967 | PRIMARY | 23 |
---|
![]() |
Primer_f | GTCCTAGTGCTTCCGAATCAT |
---|---|
Primer_r | TCCGTTGCTGCCAGTCTATTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |