Order Kazusa clone(s) from : ![]() |
Product ID | ORK00803 |
---|---|
Accession No | AB037746 |
Description | LRP2 binding protein |
Clone name | fh14327 |
Vector information | |
cDNA sequence | DNA sequence (5155 bp) Predicted protein sequence (354 aa) |
Flexi ORF Clone | FXC00803 |
Source | Human fetal brain |
Rouge ID |
mKIAA1325
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3299 bp |
---|---|
Genome contig ID | gi89161207r_186422027 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 186522027 | 186537146 | 8 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013105 | 66 | 99 | PF07719 | Tetratricopeptide TPR_2 |
IPR006597 | 140 | 175 | PF08238 | Sel1-like | |
IPR006597 | 180 | 213 | PF08238 | Sel1-like | |
IPR006597 | 214 | 249 | PF08238 | Sel1-like | |
IPR006597 | 304 | 339 | PF08238 | Sel1-like | |
HMMSmart | IPR006597 | 97 | 132 | SM00671 | Sel1-like |
IPR006597 | 140 | 175 | SM00671 | Sel1-like | |
IPR006597 | 180 | 213 | SM00671 | Sel1-like | |
IPR006597 | 214 | 249 | SM00671 | Sel1-like | |
IPR006597 | 304 | 339 | SM00671 | Sel1-like | |
ProfileScan | IPR013026 | 66 | 99 | PS50005 | Tetratricopeptide region |
IPR013026 | 66 | 99 | PS50293 | Tetratricopeptide region |
![]() |
Primer_f | ACTAAGAACTGTTGAATGGCA |
---|---|
Primer_r | AAGTGGTTGAAGGAATGTTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |