KIAA1325

Product ID	ORK00803
Accession No	AB037746
Description	LRP2 binding protein
Clone name	fh14327
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5155 bp) Predicted protein sequence (354 aa)
HaloTag ORF Clone	FHC00803
Flexi ORF Clone	FXC00803
Source	Human fetal brain
Rouge ID	mKIAA1325 by Kazusa Mouse cDNA Project

Length: 5155 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3299 bp
Genome contig ID	gi89161207r_186422027
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAAAATAAAGACAATAAAATCTTCACAATAACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACACAAAGCATTGCATAACAATGTTCTTCAATATACATGAAATAATATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	186522027	186537146	8	99.1	Perfect prediction

Length: 354 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9P2M1	1e-148	100.0	LRP2-binding pr...	Homo sapiens
CAB82313	9e-148	99.4	hypothetical pr...	Homo sapiens
XP_001085019	4.3e-143	96.0	similar to LRP2...	Macaca mulatta
Q4R3N2	1.7e-142	95.7	LRP2-binding pr...	Macaca fascicularis
XP_001490987	1.7e-138	92.0	similar to LRP2...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018289	7.2e-06	23.9	KIAA0746
D50931	0.00044	24.7	KIAA0141

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	66	99	PF07719	Tetratricopeptide TPR_2
	IPR006597	140	175	PF08238	Sel1-like
	IPR006597	180	213	PF08238	Sel1-like
	IPR006597	214	249	PF08238	Sel1-like
	IPR006597	304	339	PF08238	Sel1-like
HMMSmart	IPR006597	97	132	SM00671	Sel1-like
	IPR006597	140	175	SM00671	Sel1-like
	IPR006597	180	213	SM00671	Sel1-like
	IPR006597	214	249	SM00671	Sel1-like
	IPR006597	304	339	SM00671	Sel1-like
ProfileScan	IPR013026	66	99	PS50005	Tetratricopeptide region
ProfileScan	IPR013026	66	99	PS50293	Tetratricopeptide region

Primer_f	ACTAAGAACTGTTGAATGGCA
Primer_r	AAGTGGTTGAAGGAATGTTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-