KIAA0141

Product ID	ORK00425
Accession No	D50931
Description	KIAA0141, transcript variant 1
Clone name	ha03721
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3020 bp) Predicted protein sequence (536 aa)
HaloTag ORF Clone	FHC00425
Flexi ORF Clone	FXC00425
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0141 by Kazusa Mouse cDNA Project

Length: 3020 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1392 bp
Genome contig ID	gi51511721f_141183611
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CTAGGTGTTTAATAAAACAGATATTGGATTATCTC
Flanking genome sequence (116291 - 116340)	----+--------+--------+--------+--------+----* ATCACTCTTGCCCTTGAGTATTATGGGAAGAGCCAGGGAGACGGGCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	141283611	141299900	12	100.0	Perfect prediction

Length: 536 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF85558	5.6e-203	99.8	unnamed protein...	Homo sapiens
XP_001091095	3.2e-191	94.0	similar to CG10...	Macaca mulatta
XP_544318	4.3e-160	81.0	similar to CG10...	Canis lupus fam...
EDL76436	1.1e-140	73.7	SEL1 domain con...	Rattus norvegicus
BAE42690	1.1e-137	72.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006597	266	297	PF08238	Sel1-like
	IPR006597	298	333	PF08238	Sel1-like
	IPR006597	334	371	PF08238	Sel1-like
	IPR006597	372	405	PF08238	Sel1-like
	IPR006597	406	441	PF08238	Sel1-like
HMMSmart	IPR006597	266	297	SM00671	Sel1-like
	IPR006597	298	333	SM00671	Sel1-like
	IPR006597	334	371	SM00671	Sel1-like
	IPR006597	372	405	SM00671	Sel1-like
	IPR006597	406	441	SM00671	Sel1-like

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACAGTCAAGAAGAGGAAAGTG
Primer_r	GTAGGAGGGCAGACACCATTG
PCR product length	140 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles