KIAA0759

Product ID	ORK00626
Accession No	AB018302
Description	angel homolog 1 (Drosophila)
Clone name	hk04621
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4006 bp) Predicted protein sequence (673 aa)
HaloTag ORF Clone	FHC00626
Flexi ORF Clone	FXC00626
Source	Human adult brain
Rouge ID	mKIAA0759 by Kazusa Mouse cDNA Project

Length: 4006 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1983 bp
Genome contig ID	gi51511730r_76223341
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CTTTTTCCAAATAAAGGTTTACCTTTTTTCCCCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTTGTTCATTTTATTAGGATCCTGAAGGGATTAGGTCCTTGAGAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	76323341	76348933	10	99.5	Perfect prediction

Length: 673 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH28714	99.9	Angel homolog 1...	Homo sapiens
XP_001163194	99.4	angel homolog 1...	Pan troglodytes
EAW81261	99.3	angel homolog 1...	Homo sapiens
XP_510084	99.4	angel homolog 1...	Pan troglodytes
XP_001163086	99.4	angel homolog 1...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033020	0.00059	31.6	KIAA1194

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005135	248	666	PF03372	Endonuclease/exonuclease/phosphatase

Primer_f	CCACCATTCATTCTGTCTGTC
Primer_r	CTATCAAGCATCTGCCCTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCACCATTCATTCTGTCTGTC
Primer_r	CTATCAAGCATCTGCCCTCTG
PCR product length	159 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles