KIAA1194

Product ID	ORK00760
Accession No	AB033020
Description	CCR4-NOT transcription complex, subunit 6
Clone name	fg00908
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6255 bp) Predicted protein sequence (575 aa)
HaloTag ORF Clone	FHC00760
Flexi ORF Clone	FXC00760
Source	Human fetal brain
Rouge ID	mKIAA1194 by Kazusa Mouse cDNA Project

Length: 6255 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4157 bp
Genome contig ID	gi51511721f_179754180
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGGTTGACATATTTTAAATAAATGCTTTTAAATAC
Flanking genome sequence (183777 - 183826)	----+--------+--------+--------+--------+----* AGTAGCAAACATTGTGTTGGGGTTATAATAATTCATTAAATGTCTTGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	179854039	179937955	14	99.3	Perfect prediction

Length: 575 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULM6	100.0	CCR4-NOT transc...	Homo sapiens
XP_538584	98.0	similar to CCR4...	Canis lupus fam...
XP_001500898	97.8	CCR4-NOT transc...	Equus caballus
AAI50117	97.5	CNOT6 protein [...	Bos taurus
XP_001381153	95.9	similar to CCR4...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037858	7.4e-08	38.1	KIAA1437
D63481	1.5e-07	40.8	KIAA0147
AB023148	3.3e-07	31.0	KIAA0931
AB020669	4.6e-07	32.8	KIAA0862
AB051461	1.1e-06	31.6	KIAA1674

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	71	84	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	91	104	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	70	91	PF00560	Leucine-rich repeat
	IPR001611	93	114	PF00560	Leucine-rich repeat
	IPR001611	116	137	PF00560	Leucine-rich repeat
	IPR005135	207	556	PF03372	Endonuclease/exonuclease/phosphatase
HMMSmart	IPR003591	68	90	SM00369	Leucine-rich repeat
	IPR003591	91	113	SM00369	Leucine-rich repeat
	IPR003591	114	137	SM00369	Leucine-rich repeat

Primer_f	ACTGTGTTGGTAATGTGCATC
Primer_r	ATAAAGCTCTCTGGACCTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-