Gene/Protein Characteristic Table for KIAA0862
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00664
Accession No AB020669
Description SHOC2 leucine-rich repeat scaffold protein, transcript variant 1
Clone name hk06532
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3872 bp)
Predicted protein sequence (584 aa)
Flexi ORF Clone FXC00664
Source Human adult brain
Rouge ID mKIAA0862 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3872 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1846 bp
Genome contig ID gi89161187f_112569363
PolyA signal sequence
(TATAAA,-33)		 
+----*----+----*----+----*----+----
TTTATAAAAGGAATTTGTTTATTACAGCTCTACCT
Flanking genome sequence
(194051 - 194100)		 
----+----*----+----*----+----*----+----*----+----*
AGAGCTTGTGTGTTTGTGTGGTTTTTTAAATCTCGTATCCAGGTGTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 10 f 112669363 112763412 9 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 584 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG09878 1.3e-216 100.0 leucine-rich re...
 synthetic construct
Q9UQ13 2.3e-216 99.8 Leucine-rich re...
 Homo sapiens
XP_001087610 4.1e-216 99.7 soc-2 suppresso...
 Macaca mulatta
BAF85522 4.7e-216 99.7 unnamed protein...
 Homo sapiens
A6QLV3 4.7e-216 99.7 Leucine-rich re...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D63481 9.4e-20 33.6 KIAA0147
AB033051 3.9e-19 29.7 KIAA1225
AB023148 1.7e-17 27.5 KIAA0931
AB011178 1.9e-15 28.2 KIAA0606
D86984 4.3e-15 27.4 KIAA0231
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 150 163 PR00019 Leucine-rich repeat
IPR001611 170 183 PR00019 Leucine-rich repeat
HMMPfam IPR001611 126 147 PF00560 Leucine-rich repeat
IPR001611 149 170 PF00560 Leucine-rich repeat
IPR001611 172 193 PF00560 Leucine-rich repeat
IPR001611 195 216 PF00560 Leucine-rich repeat
IPR001611 218 239 PF00560 Leucine-rich repeat
IPR001611 241 262 PF00560 Leucine-rich repeat
IPR001611 264 285 PF00560 Leucine-rich repeat
IPR001611 287 308 PF00560 Leucine-rich repeat
IPR001611 310 332 PF00560 Leucine-rich repeat
IPR001611 358 380 PF00560 Leucine-rich repeat
IPR001611 382 403 PF00560 Leucine-rich repeat
IPR001611 405 426 PF00560 Leucine-rich repeat
IPR001611 428 449 PF00560 Leucine-rich repeat
IPR001611 451 472 PF00560 Leucine-rich repeat
IPR001611 474 495 PF00560 Leucine-rich repeat
IPR001611 497 518 PF00560 Leucine-rich repeat
IPR001611 520 542 PF00560 Leucine-rich repeat
HMMSmart IPR003591 124 146 SM00369 Leucine-rich repeat
NULL 124 143 SM00364 NULL
NULL 124 142 SM00365 NULL
IPR003591 147 169 SM00369 Leucine-rich repeat
NULL 147 166 SM00364 NULL
NULL 170 189 SM00364 NULL
NULL 170 191 SM00365 NULL
IPR003591 170 192 SM00369 Leucine-rich repeat
NULL 193 218 SM00365 NULL
IPR003591 193 215 SM00369 Leucine-rich repeat
NULL 216 235 SM00364 NULL
IPR003591 216 237 SM00369 Leucine-rich repeat
IPR003591 239 262 SM00369 Leucine-rich repeat
NULL 239 258 SM00364 NULL
NULL 239 270 SM00365 NULL
NULL 262 281 SM00364 NULL
NULL 285 304 SM00364 NULL
IPR003591 285 308 SM00369 Leucine-rich repeat
NULL 308 327 SM00364 NULL
IPR003591 309 331 SM00369 Leucine-rich repeat
IPR003591 332 355 SM00369 Leucine-rich repeat
IPR003591 356 379 SM00369 Leucine-rich repeat
IPR003591 403 425 SM00369 Leucine-rich repeat
IPR003591 426 448 SM00369 Leucine-rich repeat
NULL 426 445 SM00364 NULL
NULL 449 468 SM00364 NULL
NULL 449 467 SM00365 NULL
IPR003591 449 471 SM00369 Leucine-rich repeat
NULL 472 491 SM00364 NULL
IPR003591 472 494 SM00369 Leucine-rich repeat
NULL 495 523 SM00365 NULL
IPR003591 495 516 SM00369 Leucine-rich repeat
NULL 495 514 SM00364 NULL
IPR003591 518 542 SM00369 Leucine-rich repeat
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACTGTTGTTCTGCTTTTCCTG
Primer_r TCTTCACCTGCCTTCCATTTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 10
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp