KIAA1225

Product ID	ORK00772
Accession No	AB033051
Description	erbb2 interacting protein, transcript variant 2
Clone name	fh04221s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1450) was subcloned upstream of the cDNA (1451-6064). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGCGAC CCACGCGTCC GCGGACGCGT GGGTCGAGGC CGCGGGAATT CGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6064 bp) Predicted protein sequence (1371 aa)
HaloTag ORF Clone	FHC00772
Flexi ORF Clone	FXC00772
Source	Human fetal brain
Rouge ID	mKIAA1225 by Kazusa Mouse cDNA Project
Note	We replaced fh04221, former representative clones for KIAA1225 with fh04221s1. (2002/5/10)

Length: 6064 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1948 bp
Genome contig ID	gi51511721f_65224303
PolyA signal sequence (None)	+--------+--------+----*----+---- GATAAAATTCACTTATTGTATGTGTGTTGTAATCT
Flanking genome sequence (187761 - 187810)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAATGACAAACAGCTTCTTTAAGACAAGTCTCGGTGTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	65324303	65412062	23	99.9	Perfect prediction

Length: 1371 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI26465	99.9	Erbb2 interacti...	Homo sapiens
XP_001162804	99.8	ERBB2 interacti...	Pan troglodytes
AAI15013	99.6	Erbb2 interacti...	Homo sapiens
AAI15016	99.1	ERBB2IP protein...	Homo sapiens
BAG65463	98.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63481	1.7e-40	39.1	KIAA0147
AB020669	7.9e-13	29.7	KIAA0862
AB037786	3.4e-11	32.1	KIAA1365
AB023233	7.3e-06	22.7	KIAA1016
AB037858	8.7e-06	28.0	KIAA1437

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	232	245	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	367	380	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	47	68	PF00560	Leucine-rich repeat
	IPR001611	70	91	PF00560	Leucine-rich repeat
	IPR001611	93	114	PF00560	Leucine-rich repeat
	IPR001611	139	160	PF00560	Leucine-rich repeat
	IPR001611	162	183	PF00560	Leucine-rich repeat
	IPR001611	185	206	PF00560	Leucine-rich repeat
	IPR001611	231	252	PF00560	Leucine-rich repeat
	IPR001611	254	275	PF00560	Leucine-rich repeat
	IPR001611	277	298	PF00560	Leucine-rich repeat
	IPR001611	300	321	PF00560	Leucine-rich repeat
	IPR001611	346	367	PF00560	Leucine-rich repeat
	IPR001611	369	390	PF00560	Leucine-rich repeat
	IPR001478	1282	1366	PF00595	PDZ/DHR/GLGF
HMMSmart	NULL	45	63	SM00365	NULL
	NULL	45	64	SM00364	NULL
	IPR003591	48	68	SM00369	Leucine-rich repeat
	NULL	68	87	SM00364	NULL
	NULL	91	113	SM00365	NULL
	NULL	91	110	SM00364	NULL
	IPR003591	91	114	SM00369	Leucine-rich repeat
	IPR003591	137	159	SM00369	Leucine-rich repeat
	NULL	160	191	SM00365	NULL
	IPR003591	160	182	SM00369	Leucine-rich repeat
	NULL	160	179	SM00364	NULL
	NULL	183	202	SM00364	NULL
	IPR003591	183	205	SM00369	Leucine-rich repeat
	NULL	206	227	SM00365	NULL
	IPR003591	206	228	SM00369	Leucine-rich repeat
	IPR003591	229	252	SM00369	Leucine-rich repeat
	NULL	229	251	SM00365	NULL
	NULL	252	271	SM00364	NULL
	IPR003591	253	274	SM00369	Leucine-rich repeat
	IPR003591	275	298	SM00369	Leucine-rich repeat
	NULL	275	294	SM00364	NULL
	IPR003591	321	344	SM00369	Leucine-rich repeat
	NULL	345	363	SM00364	NULL
	IPR003591	345	366	SM00369	Leucine-rich repeat
	NULL	367	386	SM00364	NULL
	NULL	367	385	SM00365	NULL
	IPR003591	367	389	SM00369	Leucine-rich repeat
	NULL	390	411	SM00365	NULL
	IPR001478	1289	1369	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	1280	1369	PS50106	PDZ/DHR/GLGF

Primer_f	TTCGAGCTAATACTGCATACC
Primer_r	TCACCAAGATTTACAGAGGCT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-