KIAA0147

Product ID	ORK00428
Accession No	D63481
Description	scribbled planar cell polarity protein, transcript variant 2
Clone name	ha01022s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5132 bp) Predicted protein sequence (1630 aa)
HaloTag ORF Clone	FHC00428
Flexi ORF Clone	FXC00428
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0147 by Kazusa Mouse cDNA Project
Note	We replaced ha01022, former representative clones for KIAA0147 with ha01022s1. (2002/5/10)

Length: 5132 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	237 bp
Genome contig ID	gi51511724r_144845084
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGTGGTTTAAGGAGAATAAAGTTGACTACATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTCCCGTCTGCCTGTCCATCCCCCACCCACTAGCACAGACCCTTCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	144945084	144969532	36	99.6	Perfect prediction

Length: 1630 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL38976	99.9	scribble [Homo ...	Homo sapiens
EAW82198	99.5	scribbled homol...	Homo sapiens
AAI46322	98.5	Scribbled homol...	synthetic construct
EAW82197	98.0	scribbled homol...	Homo sapiens
AAP88018	100.0	SCRIB1 variant ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033051	3e-27	39.2	KIAA1225
AB020669	2.4e-08	33.6	KIAA0862
AB037858	0.00038	30.6	KIAA1437
AB011178	0.00083	27.6	KIAA0606

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	61	74	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	173	186	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	37	59	PF00560	Leucine-rich repeat
	IPR001611	60	81	PF00560	Leucine-rich repeat
	IPR001611	83	104	PF00560	Leucine-rich repeat
	IPR001611	106	127	PF00560	Leucine-rich repeat
	IPR001611	152	173	PF00560	Leucine-rich repeat
	IPR001611	175	196	PF00560	Leucine-rich repeat
	IPR001611	198	219	PF00560	Leucine-rich repeat
	IPR001611	221	242	PF00560	Leucine-rich repeat
	IPR001611	290	311	PF00560	Leucine-rich repeat
	IPR001611	313	334	PF00560	Leucine-rich repeat
	IPR001611	336	357	PF00560	Leucine-rich repeat
	IPR001611	359	380	PF00560	Leucine-rich repeat
	IPR001478	728	812	PF00595	PDZ/DHR/GLGF
	IPR001478	871	947	PF00595	PDZ/DHR/GLGF
	IPR001478	1004	1090	PF00595	PDZ/DHR/GLGF
	IPR001478	1100	1189	PF00595	PDZ/DHR/GLGF
HMMSmart	NULL	35	54	SM00364	NULL
	IPR003591	58	80	SM00369	Leucine-rich repeat
	IPR003591	81	104	SM00369	Leucine-rich repeat
	NULL	83	100	SM00364	NULL
	IPR003591	127	149	SM00369	Leucine-rich repeat
	NULL	150	169	SM00364	NULL
	IPR003591	150	172	SM00369	Leucine-rich repeat
	NULL	173	192	SM00364	NULL
	IPR003591	173	195	SM00369	Leucine-rich repeat
	NULL	196	216	SM00364	NULL
	IPR003591	196	218	SM00369	Leucine-rich repeat
	IPR003591	219	241	SM00369	Leucine-rich repeat
	NULL	219	238	SM00364	NULL
	NULL	242	261	SM00364	NULL
	IPR003591	242	265	SM00369	Leucine-rich repeat
	NULL	265	284	SM00364	NULL
	IPR003591	311	334	SM00369	Leucine-rich repeat
	NULL	311	330	SM00364	NULL
	IPR003591	335	356	SM00369	Leucine-rich repeat
	NULL	357	376	SM00364	NULL
	IPR003591	357	380	SM00369	Leucine-rich repeat
	IPR001478	736	815	SM00228	PDZ/DHR/GLGF
	IPR001478	870	950	SM00228	PDZ/DHR/GLGF
	IPR001478	1012	1093	SM00228	PDZ/DHR/GLGF
	IPR001478	1109	1192	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	728	815	PS50106	PDZ/DHR/GLGF
	IPR001478	862	950	PS50106	PDZ/DHR/GLGF
	IPR001478	1004	1093	PS50106	PDZ/DHR/GLGF
	IPR001478	1100	1188	PS50106	PDZ/DHR/GLGF

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AAGTTCTGCAAGGCTCTGGAG
Primer_r	GGCAGCACTTCCAGATCGTTG
PCR product length	148 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles