KIAA0606

Product ID	ORK01103
Accession No	AB011178
Description	PH domain and leucine rich repeat protein phosphatase 1
Clone name	ph00195
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5113 bp) Predicted protein sequence (1369 aa)
HaloTag ORF Clone	FHC01103
Flexi ORF Clone	FXC01103
Source	Human brain (hippocampus)
Rouge ID	mKIAA0606 by Kazusa Mouse cDNA Project
Note	We replaced hg04452a, former representative clones for KIAA0606 with ph00195. (2002/5/10)

Length: 5113 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1001 bp
Genome contig ID	gi51511735f_58434939
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TAATTTTTGTTACAATAAATATGAAATTTACAAGT
Flanking genome sequence (363708 - 363757)	----+--------+--------+--------+--------+----* ATTTACAAGTATCTGCTTTTGTCTCAGCAGCCAGATGTTTCTTGGAGACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	58534939	58798645	17	99.9	Perfect prediction

Length: 1369 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60346	99.9	PH domain leuci...	Homo sapiens
XP_523952	99.2	PH domain and l...	Pan troglodytes
XP_001094216	98.7	PH domain and l...	Macaca mulatta
EDL91741	90.4	PH domain and l...	Rattus norvegicus
Q9WTR8	90.4	PH domain leuci...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023148	3.6e-55	51.4	KIAA0931
AB020669	1.6e-08	28.1	KIAA0862
D63481	1.4e-05	27.6	KIAA0147

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	548	561	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	711	724	PR00019	Leucine-rich repeat
HMMPfam	IPR001849	189	288	PF00169	Pleckstrin-like
	IPR001611	290	308	PF00560	Leucine-rich repeat
	IPR001611	344	365	PF00560	Leucine-rich repeat
	IPR001611	367	388	PF00560	Leucine-rich repeat
	IPR001611	390	411	PF00560	Leucine-rich repeat
	IPR001611	413	434	PF00560	Leucine-rich repeat
	IPR001611	570	592	PF00560	Leucine-rich repeat
	IPR001611	615	633	PF00560	Leucine-rich repeat
	IPR001611	639	661	PF00560	Leucine-rich repeat
	IPR001611	689	711	PF00560	Leucine-rich repeat
	IPR001611	713	734	PF00560	Leucine-rich repeat
	IPR001611	781	803	PF00560	Leucine-rich repeat
	IPR014045	826	1067	PF00481	Protein phosphatase 2C
HMMSmart	IPR003591	342	365	SM00369	Leucine-rich repeat
	NULL	344	361	SM00364	NULL
	NULL	365	384	SM00364	NULL
	IPR003591	388	410	SM00369	Leucine-rich repeat
	IPR003591	411	433	SM00369	Leucine-rich repeat
	NULL	411	430	SM00364	NULL
	IPR003591	434	457	SM00369	Leucine-rich repeat
	IPR003591	482	505	SM00369	Leucine-rich repeat
	NULL	545	564	SM00364	NULL
	NULL	568	587	SM00364	NULL
	IPR003591	569	591	SM00369	Leucine-rich repeat
	NULL	591	610	SM00364	NULL
	IPR003591	592	614	SM00369	Leucine-rich repeat
	NULL	615	632	SM00364	NULL
	IPR003591	615	636	SM00369	Leucine-rich repeat
	NULL	637	656	SM00364	NULL
	IPR003591	639	660	SM00369	Leucine-rich repeat
	NULL	687	706	SM00364	NULL
	NULL	711	730	SM00364	NULL
	IPR003591	711	734	SM00369	Leucine-rich repeat
	IPR001932	817	1072	SM00332	Protein phosphatase 2C-related
ProfileScan	IPR001849	188	288	PS50003	Pleckstrin-like

Primer_f	TGTCCCAGCCTTCCCACTTTG
Primer_r	ACTCTGGGTATGTAAATGGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGTCCCAGCCTTCCCACTTTG
Primer_r	ACTCTGGGTATGTAAATGGCC
PCR product length	107 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles