KIAA1365

Product ID	ORK05881
Accession No	AB037786
Description	leucine rich repeat containing 7
Clone name	fj02517
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4150 bp) Predicted protein sequence (831 aa)
Source	Human fetal brain
Rouge ID	mKIAA1365 by Kazusa Mouse cDNA Project

Length: 4150 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1594 bp
Genome contig ID	gi89161185f_70174429
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TATTTTTGTAGGGTCTATTAAAATGAGTGTCACTT
Flanking genome sequence (187325 - 187374)	----+--------+--------+--------+--------+----* ATTAGAAGTACAGTGGTATTTTTTGGCAATAGAATTTGTCACTTGGGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	70274429	70361752	8	99.6	Perfect prediction

Length: 831 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH70975	99.8	leucine rich re...	Homo sapiens
EAX06461	99.8	leucine rich re...	Homo sapiens
Q80TE7	93.3	Leucine-rich re...	Mus musculus
EDL11847	93.3	mCG11661 [Mus m...	Mus musculus
P70587	93.1	Leucine-rich re...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033051	9.6e-13	32.3	KIAA1225

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	742	826	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	749	829	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	744	829	PS50106	PDZ/DHR/GLGF

Primer_f	AACTGTAGCCCCTGTGATTTC
Primer_r	CTTTCTAACAGCAGTCTTTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACTGTAGCCCCTGTGATTTC
Primer_r	CTTTCTAACAGCAGTCTTTCG
PCR product length	144 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles