Order Kazusa clone(s) from : ![]() |
Product ID | ORK00885 |
---|---|
Accession No | AB051461 |
Description | leucine rich repeat containing 27, transcript variant 1 |
Clone name | fg03838 |
Vector information | |
cDNA sequence | DNA sequence (6382 bp) Predicted protein sequence (538 aa) |
HaloTag ORF Clone |
FHC00885
![]() |
Flexi ORF Clone | FXC00885 |
Source | Human fetal brain |
Rouge ID |
mKIAA1674
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 4684 bp |
---|---|
Genome contig ID | gi89161187f_133895694 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (147720 - 147769) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 133995694 | 134043412 | 11 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001611 | 76 | 98 | PF00560 | Leucine-rich repeat |
IPR001611 | 100 | 121 | PF00560 | Leucine-rich repeat | |
IPR001611 | 123 | 144 | PF00560 | Leucine-rich repeat | |
HMMSmart | IPR003591 | 74 | 97 | SM00369 | Leucine-rich repeat |
IPR003591 | 98 | 121 | SM00369 | Leucine-rich repeat | |
IPR003591 | 122 | 144 | SM00369 | Leucine-rich repeat |
![]() |
Primer_f | CAAGGAGGATGAGCTGCTGTC |
---|---|
Primer_r | AAGATGATGCCTCCAACACCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCACAATGCCACCTGACTGAG |
Primer_r | GTGGCCTTTGGTGTAACTCTC |
PCR product length | 216 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |