Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00125 |
---|---|
Accession No | AB018304 |
Description | chloride channel CLIC-like 1, transcript variant 1 |
Clone name | hk04655s1 |
Vector information | |
cDNA sequence | DNA sequence (4696 bp) Predicted protein sequence (551 aa) |
HaloTag ORF Clone |
FHC00125
|
Flexi ORF Clone | FXC00125 |
Source | Human adult brain |
Note | We replaced hk04655, former representative clones for KIAA0761 with hk04655s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3039 bp |
---|---|
Genome contig ID | gi89161185r_109173653 |
PolyA signal sequence (AAGAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 109273653 | 109294583 | 11 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR009231 | 3 | 551 | PF05934 | Mid-1-related chloride channel |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | MLCSLLLCECLLLVAGYAHDDDW | 23 | PRIMARY | 23 | 2 | 181 | DPYNVLMVLLCLLCIVVLVATEL | 203 | PRIMARY | 23 | 3 | 216 | VLIISFLFSLGWNWMYLYKLAFA | 238 | SECONDARY | 23 | 4 | 329 | EIPALLHLPVLIIMALAILSFCY | 351 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CTGTTCATCCATTCTCTTTCC |
---|---|
Primer_r | GACTGAGAGATTTAACATAGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTGTTCATCCATTCTCTTTCC |
Primer_r | GACTGAGAGATTTAACATAGC |
PCR product length | 197 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |