KIAA0766

Product ID	ORK00127
Accession No	AB018309
Description	EPM2A (laforin) interacting protein 1
Clone name	hk04860
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4185 bp) Predicted protein sequence (640 aa)
HaloTag ORF Clone	FHC00127
Flexi ORF Clone	FXC00127
Source	Human adult brain
Rouge ID	mKIAA0766 by Kazusa Mouse cDNA Project

Length: 4185 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2245 bp
Genome contig ID	gi89161205r_36905502
PolyA signal sequence (None)	+--------+--------+----*----+---- CTATAGAGAATTTGCTATAAGCTAGTCTTGTTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGAAAAAGAAAAAAGTGTATTTTACTGTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	37005502	37009688	1	99.0	Perfect prediction

Length: 640 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L775	100.0	EPM2A-interacti...	Homo sapiens
XP_526480	99.5	hypothetical pr...	Pan troglodytes
CAH91011	99.2	hypothetical pr...	Pongo abelii
XP_001090676	97.5	EPM2A interacti...	Macaca mulatta
XP_851144	91.1	similar to EPM2...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067512	8.8e-19	23.5	KIAA1925
AB037774	1.5e-18	22.0	KIAA1353

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TTATCAAGAATGGTCAAGCTG
Primer_r	CTCTCAAGTAATAAAGCTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTATCAAGAATGGTCAAGCTG
Primer_r	CTCTCAAGTAATAAAGCTCTG
PCR product length	157 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles