KIAA1353

Gene/Protein Characteristic Table for KIAA1353

Order Kazusa clone(s) from :

Product ID	ORK07436
Accession No	AB037774
Description	zinc finger, MYM-type 6
Clone name	fj01443
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3877 bp) Predicted protein sequence (640 aa)
Source	Human fetal brain

Length: 3877 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	122 bp
Genome contig ID	gi89161185r_35125170
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTGTGTTTTCAGTGATTAAATGTTTTAATAATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCCTTTTTGTTGAGGAATTTAATAATTATGATTGTTATAAATAATTATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	35225170	35229046	1	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 640 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX07434	100.0	hCG1812640 [Hom...	Homo sapiens
O95789	99.7	Zinc finger MYM...	Homo sapiens
XP_001166528	99.5	zinc finger pro...	Pan troglodytes
ABF22698	100.0	transposase-lik...	Homo sapiens
BAA91430	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067512	7.7e-97	41.1	KIAA1925
AB018309	1.5e-17	22.0	KIAA0766
AB011115	0.00012	21.2	KIAA0543
AB046806	0.00019	22.1	KIAA1586

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GGTGCTTGGGATTACTTGTAC
Primer_r	GTTCTTTATGTATCTCCCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GGTGCTTGGGATTACTTGTAC
Primer_r	GTTCTTTATGTATCTCCCCAC
PCR product length	208 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp