Gene/Protein Characteristic Table for KIAA1586
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00871
Accession No AB046806
Description KIAA1586
Clone name fj08085
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4061 bp)
Predicted protein sequence (739 aa)
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 4061 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 739 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX04470 0 100.0 hCG42061 [Homo ...
Homo sapiens
BAG58434 0 99.9 unnamed protein...
Homo sapiens
XP_001110391 0 96.1 similar to zinc...
Macaca mulatta
BAF83677 0 100.0 unnamed protein...
Homo sapiens
XP_001370079 1.9e-16 21.3 similar to hCG1...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011115 7.4e-18 22.4 KIAA0543
AB067512 3.5e-06 22.1 KIAA1925
AB037774 0.00021 21.3 KIAA1353
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TAGAGATTGGCCCATGTTTGC
Primer_r CCTCCAGGGCTTAGAACTTAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name RH-map
Primer_f TAGAGATTGGCCCATGTTTGC
Primer_r CCTCCAGGGCTTAGAACTTAG
PCR product length 151 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp