Order Kazusa clone(s) from : ![]() |
Product ID | ORK05609 |
---|---|
Accession No | AB011115 |
Description | zinc finger protein 862 |
Clone name | hg04390 |
Vector information | |
cDNA sequence | DNA sequence (6443 bp) Predicted protein sequence (1111 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0543
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3106 bp |
---|---|
Genome contig ID | gi89161213f_149074210 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (121290 - 121339) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 149174210 | 149195498 | 7 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001909 | 275 | 315 | PF01352 | KRAB box |
IPR008906 | 931 | 1014 | PF05699 | HAT dimerisation | |
HMMSmart | IPR006580 | 77 | 160 | SM00597 | Zinc finger |
IPR001909 | 275 | 335 | SM00349 | KRAB box | |
IPR006580 | 403 | 486 | SM00597 | Zinc finger | |
ProfileScan | IPR001909 | 275 | 346 | PS50805 | KRAB box |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 961 | FPLLSKLMAVVVCVPISTSCCER | 983 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | GGGTCTGACATTCCAAGTAAC |
---|---|
Primer_r | AGGTATCTTCCAGGACAGGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGGTCTGACATTCCAAGTAAC |
Primer_r | AGGTATCTTCCAGGACAGGGG |
PCR product length | 109 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |