Order Kazusa clone(s) from : ![]() |
Product ID | ORK07459 |
---|---|
Accession No | AB058709 |
Description | zinc finger protein 333 |
Clone name | fk00438 |
Vector information | |
cDNA sequence | DNA sequence (3079 bp) Predicted protein sequence (481 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1633 bp |
---|---|
Genome contig ID | gi42406306f_14587235 |
PolyA signal sequence (ATTAAA,-34) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (105537 - 105586) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 14687235 | 14692770 | 5 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 182 | 205 | PD000003 | Zinc finger |
IPR007087 | 210 | 233 | PD000003 | Zinc finger | |
IPR007087 | 238 | 261 | PD000003 | Zinc finger | |
IPR007087 | 266 | 289 | PD000003 | Zinc finger | |
IPR007087 | 294 | 317 | PD000003 | Zinc finger | |
IPR007087 | 322 | 345 | PD000003 | Zinc finger | |
IPR007087 | 378 | 401 | PD000003 | Zinc finger | |
IPR007087 | 406 | 429 | PD000003 | Zinc finger | |
IPR007087 | 434 | 456 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 19 | 59 | PF01352 | KRAB box |
IPR007087 | 182 | 204 | PF00096 | Zinc finger | |
IPR007087 | 210 | 232 | PF00096 | Zinc finger | |
IPR007087 | 238 | 260 | PF00096 | Zinc finger | |
IPR007087 | 266 | 288 | PF00096 | Zinc finger | |
IPR007087 | 294 | 316 | PF00096 | Zinc finger | |
IPR007087 | 322 | 344 | PF00096 | Zinc finger | |
IPR007087 | 350 | 372 | PF00096 | Zinc finger | |
IPR007087 | 378 | 400 | PF00096 | Zinc finger | |
IPR007087 | 406 | 428 | PF00096 | Zinc finger | |
IPR007087 | 434 | 456 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 19 | 79 | SM00349 | KRAB box |
IPR015880 | 182 | 204 | SM00355 | Zinc finger | |
IPR003656 | 192 | 235 | SM00614 | Zinc finger | |
IPR015880 | 210 | 232 | SM00355 | Zinc finger | |
IPR015880 | 238 | 260 | SM00355 | Zinc finger | |
IPR015880 | 266 | 288 | SM00355 | Zinc finger | |
IPR015880 | 294 | 316 | SM00355 | Zinc finger | |
IPR015880 | 322 | 344 | SM00355 | Zinc finger | |
IPR003656 | 331 | 375 | SM00614 | Zinc finger | |
IPR015880 | 350 | 372 | SM00355 | Zinc finger | |
IPR015880 | 378 | 400 | SM00355 | Zinc finger | |
IPR015880 | 406 | 428 | SM00355 | Zinc finger | |
IPR015880 | 434 | 456 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 19 | 90 | PS50805 | KRAB box |
IPR007087 | 182 | 209 | PS50157 | Zinc finger | |
IPR007087 | 210 | 237 | PS50157 | Zinc finger | |
IPR007087 | 238 | 265 | PS50157 | Zinc finger | |
IPR007087 | 266 | 293 | PS50157 | Zinc finger | |
IPR007087 | 294 | 321 | PS50157 | Zinc finger | |
IPR007087 | 322 | 349 | PS50157 | Zinc finger | |
IPR007087 | 350 | 377 | PS50157 | Zinc finger | |
IPR007087 | 378 | 405 | PS50157 | Zinc finger | |
IPR007087 | 406 | 433 | PS50157 | Zinc finger | |
IPR007087 | 434 | 461 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 184 | 204 | PS00028 | Zinc finger |
IPR007087 | 212 | 232 | PS00028 | Zinc finger | |
IPR007087 | 240 | 260 | PS00028 | Zinc finger | |
IPR007087 | 268 | 288 | PS00028 | Zinc finger | |
IPR007087 | 296 | 316 | PS00028 | Zinc finger | |
IPR007087 | 324 | 344 | PS00028 | Zinc finger | |
IPR007087 | 352 | 372 | PS00028 | Zinc finger | |
IPR007087 | 380 | 400 | PS00028 | Zinc finger | |
IPR007087 | 408 | 428 | PS00028 | Zinc finger | |
IPR007087 | 436 | 456 | PS00028 | Zinc finger |
![]() |
Primer_f | AGATATTGTGTTCAGGGATGG |
---|---|
Primer_r | CAGAAGCAAGATGGTTATGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |