Order Kazusa clone(s) from : ![]() |
Product ID | ORK07479 |
---|---|
Accession No | AB037817 |
Description | zinc finger protein 471 |
Clone name | hj08221 |
Vector information | |
cDNA sequence | DNA sequence (5041 bp) Predicted protein sequence (551 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1396
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 3384 bp |
---|---|
Genome contig ID | gi42406306f_61627501 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (105013 - 105062) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 61721727 | 61732512 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 131 | 154 | PD000003 | Zinc finger |
IPR007087 | 159 | 182 | PD000003 | Zinc finger | |
IPR007087 | 187 | 210 | PD000003 | Zinc finger | |
IPR007087 | 215 | 238 | PD000003 | Zinc finger | |
IPR007087 | 243 | 266 | PD000003 | Zinc finger | |
IPR007087 | 271 | 295 | PD000003 | Zinc finger | |
IPR007087 | 328 | 351 | PD000003 | Zinc finger | |
IPR007087 | 356 | 379 | PD000003 | Zinc finger | |
IPR007087 | 384 | 407 | PD000003 | Zinc finger | |
IPR007087 | 412 | 435 | PD000003 | Zinc finger | |
IPR007087 | 440 | 463 | PD000003 | Zinc finger | |
IPR007087 | 468 | 491 | PD000003 | Zinc finger | |
IPR007087 | 496 | 519 | PD000003 | Zinc finger | |
IPR007087 | 524 | 547 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 131 | 153 | PF00096 | Zinc finger |
IPR007087 | 159 | 181 | PF00096 | Zinc finger | |
IPR007087 | 187 | 209 | PF00096 | Zinc finger | |
IPR007087 | 215 | 237 | PF00096 | Zinc finger | |
IPR007087 | 243 | 265 | PF00096 | Zinc finger | |
IPR007087 | 271 | 294 | PF00096 | Zinc finger | |
IPR007087 | 300 | 322 | PF00096 | Zinc finger | |
IPR007087 | 328 | 350 | PF00096 | Zinc finger | |
IPR007087 | 356 | 378 | PF00096 | Zinc finger | |
IPR007087 | 384 | 406 | PF00096 | Zinc finger | |
IPR007087 | 412 | 434 | PF00096 | Zinc finger | |
IPR007087 | 440 | 462 | PF00096 | Zinc finger | |
IPR007087 | 468 | 490 | PF00096 | Zinc finger | |
IPR007087 | 496 | 518 | PF00096 | Zinc finger | |
IPR007087 | 524 | 546 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 131 | 153 | SM00355 | Zinc finger |
IPR015880 | 159 | 181 | SM00355 | Zinc finger | |
IPR015880 | 187 | 209 | SM00355 | Zinc finger | |
IPR015880 | 215 | 237 | SM00355 | Zinc finger | |
IPR015880 | 243 | 265 | SM00355 | Zinc finger | |
IPR015880 | 271 | 294 | SM00355 | Zinc finger | |
IPR015880 | 300 | 322 | SM00355 | Zinc finger | |
IPR015880 | 328 | 350 | SM00355 | Zinc finger | |
IPR015880 | 356 | 378 | SM00355 | Zinc finger | |
IPR015880 | 384 | 406 | SM00355 | Zinc finger | |
IPR015880 | 412 | 434 | SM00355 | Zinc finger | |
IPR015880 | 440 | 462 | SM00355 | Zinc finger | |
IPR015880 | 468 | 490 | SM00355 | Zinc finger | |
IPR015880 | 496 | 518 | SM00355 | Zinc finger | |
IPR015880 | 524 | 546 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 131 | 158 | PS50157 | Zinc finger |
IPR007087 | 159 | 186 | PS50157 | Zinc finger | |
IPR007087 | 187 | 214 | PS50157 | Zinc finger | |
IPR007087 | 215 | 242 | PS50157 | Zinc finger | |
IPR007087 | 243 | 270 | PS50157 | Zinc finger | |
IPR007087 | 271 | 299 | PS50157 | Zinc finger | |
IPR007087 | 300 | 327 | PS50157 | Zinc finger | |
IPR007087 | 328 | 355 | PS50157 | Zinc finger | |
IPR007087 | 356 | 383 | PS50157 | Zinc finger | |
IPR007087 | 384 | 411 | PS50157 | Zinc finger | |
IPR007087 | 412 | 439 | PS50157 | Zinc finger | |
IPR007087 | 440 | 467 | PS50157 | Zinc finger | |
IPR007087 | 468 | 495 | PS50157 | Zinc finger | |
IPR007087 | 496 | 523 | PS50157 | Zinc finger | |
IPR007087 | 524 | 551 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 133 | 153 | PS00028 | Zinc finger |
IPR007087 | 161 | 181 | PS00028 | Zinc finger | |
IPR007087 | 189 | 209 | PS00028 | Zinc finger | |
IPR007087 | 217 | 237 | PS00028 | Zinc finger | |
IPR007087 | 245 | 265 | PS00028 | Zinc finger | |
IPR007087 | 273 | 294 | PS00028 | Zinc finger | |
IPR007087 | 302 | 322 | PS00028 | Zinc finger | |
IPR007087 | 330 | 350 | PS00028 | Zinc finger | |
IPR007087 | 358 | 378 | PS00028 | Zinc finger | |
IPR007087 | 386 | 406 | PS00028 | Zinc finger | |
IPR007087 | 414 | 434 | PS00028 | Zinc finger | |
IPR007087 | 442 | 462 | PS00028 | Zinc finger | |
IPR007087 | 470 | 490 | PS00028 | Zinc finger | |
IPR007087 | 498 | 518 | PS00028 | Zinc finger | |
IPR007087 | 526 | 546 | PS00028 | Zinc finger |
![]() |
Primer_f | AGGGAGGTTTTGTAGAAGGTC |
---|---|
Primer_r | AAGGAGTCAAATGGGATGCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGGGAGGTTTTGTAGAAGGTC |
Primer_r | AAGGAGTCAAATGGGATGCTG |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |