Gene/Protein Characteristic Table for KIAA1431
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00831
Accession No AB037852
Description ZFP28 zinc finger protein, transcript variant 1
Clone name fj00022
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4076 bp)
Predicted protein sequence (891 aa)
Flexi ORF Clone FXC00831
Source Human fetal brain
Rouge ID mKIAA1431 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4076 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1398 bp
Genome contig ID gi42406306f_61642129
PolyA signal sequence
(AATAAA,-16)		 
+----*----+----*----+----*----+----
ATTGAAAAATAAAGATGTCAATAAAAGGAGAAATG
Flanking genome sequence
(117844 - 117893)		 
----+----*----+----*----+----*----+----*----+----*
ATATTTTTCTAGATGAAATACTCAATATTGTTAAAATGTTTGTAAATTAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 61742129 61759971 8 99.2 Perfect prediction
Features of the protein sequence
Description

Length: 891 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_512926 0 98.9 zinc finger pro...
 Pan troglodytes
BAG10060 0 100.0 zinc finger pro...
 synthetic construct
Q8NHY6 0 99.9 Zinc finger pro...
 Homo sapiens
AAI27003 0 99.7 Zinc finger pro...
 Homo sapiens
XP_853881 0 85.1 similar to zinc...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037817 3.8e-73 61.0 KIAA1396
AB046831 7.5e-66 45.0 KIAA1611
D31763 4.5e-62 41.2 KIAA0065
AB075862 2e-59 51.2 KIAA1982
AB018341 1.1e-58 43.7 KIAA0798
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 443 466 PD000003 Zinc finger
IPR007087 471 494 PD000003 Zinc finger
IPR007087 499 523 PD000003 Zinc finger
IPR007087 556 579 PD000003 Zinc finger
IPR007087 584 607 PD000003 Zinc finger
IPR007087 612 635 PD000003 Zinc finger
IPR007087 640 663 PD000003 Zinc finger
IPR007087 668 691 PD000003 Zinc finger
IPR007087 696 719 PD000003 Zinc finger
IPR007087 724 747 PD000003 Zinc finger
IPR007087 752 775 PD000003 Zinc finger
IPR007087 780 803 PD000003 Zinc finger
IPR007087 808 831 PD000003 Zinc finger
HMMPfam IPR001909 126 166 PF01352 KRAB box
IPR001909 255 291 PF01352 KRAB box
IPR007087 443 465 PF00096 Zinc finger
IPR007087 471 493 PF00096 Zinc finger
IPR007087 499 522 PF00096 Zinc finger
IPR007087 528 550 PF00096 Zinc finger
IPR007087 556 578 PF00096 Zinc finger
IPR007087 584 606 PF00096 Zinc finger
IPR007087 612 634 PF00096 Zinc finger
IPR007087 640 662 PF00096 Zinc finger
IPR007087 668 690 PF00096 Zinc finger
IPR007087 696 718 PF00096 Zinc finger
IPR007087 724 746 PF00096 Zinc finger
IPR007087 752 774 PF00096 Zinc finger
IPR007087 780 802 PF00096 Zinc finger
IPR007087 808 830 PF00096 Zinc finger
HMMSmart IPR001909 126 186 SM00349 KRAB box
IPR001909 255 311 SM00349 KRAB box
IPR015880 443 465 SM00355 Zinc finger
IPR015880 471 493 SM00355 Zinc finger
IPR015880 499 522 SM00355 Zinc finger
IPR015880 528 550 SM00355 Zinc finger
IPR015880 556 578 SM00355 Zinc finger
IPR015880 584 606 SM00355 Zinc finger
IPR015880 612 634 SM00355 Zinc finger
IPR015880 640 662 SM00355 Zinc finger
IPR015880 668 690 SM00355 Zinc finger
IPR015880 696 718 SM00355 Zinc finger
IPR015880 724 746 SM00355 Zinc finger
IPR015880 752 774 SM00355 Zinc finger
IPR015880 780 802 SM00355 Zinc finger
IPR015880 808 830 SM00355 Zinc finger
ProfileScan IPR001909 126 197 PS50805 KRAB box
IPR001909 255 322 PS50805 KRAB box
IPR007087 443 470 PS50157 Zinc finger
IPR007087 471 498 PS50157 Zinc finger
IPR007087 499 527 PS50157 Zinc finger
IPR007087 528 555 PS50157 Zinc finger
IPR007087 556 583 PS50157 Zinc finger
IPR007087 584 611 PS50157 Zinc finger
IPR007087 612 639 PS50157 Zinc finger
IPR007087 640 667 PS50157 Zinc finger
IPR007087 668 695 PS50157 Zinc finger
IPR007087 696 723 PS50157 Zinc finger
IPR007087 724 751 PS50157 Zinc finger
IPR007087 752 779 PS50157 Zinc finger
IPR007087 780 807 PS50157 Zinc finger
IPR007087 808 835 PS50157 Zinc finger
IPR007087 836 863 PS50157 Zinc finger
ScanRegExp IPR007087 445 465 PS00028 Zinc finger
IPR007087 473 493 PS00028 Zinc finger
IPR007087 501 522 PS00028 Zinc finger
IPR007087 530 550 PS00028 Zinc finger
IPR007087 558 578 PS00028 Zinc finger
IPR007087 586 606 PS00028 Zinc finger
IPR007087 614 634 PS00028 Zinc finger
IPR007087 642 662 PS00028 Zinc finger
IPR007087 670 690 PS00028 Zinc finger
IPR007087 698 718 PS00028 Zinc finger
IPR007087 726 746 PS00028 Zinc finger
IPR007087 754 774 PS00028 Zinc finger
IPR007087 782 802 PS00028 Zinc finger
IPR007087 810 830 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCTGTGTGGAAGATCAAGGAG
Primer_r CATCATAATCCCAGTGTTCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f GCTGTGTGGAAGATCAAGGAG
Primer_r CATCATAATCCCAGTGTTCCC
PCR product length 136 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp