Gene/Protein Characteristic Table for KIAA0798
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00643
Accession No AB018341
Description zinc finger protein 432
Clone name hk06584
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4517 bp)
Predicted protein sequence (682 aa)
Flexi ORF Clone FXC00643
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4517 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 682 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O94892 0 100.0 Zinc finger pro...
Homo sapiens
XP_001174404 0 99.5 zinc finger pro...
Pan troglodytes
BAF85516 0 99.7 unnamed protein...
Homo sapiens
XP_001495874 0 85.8 similar to Zinc...
Equus caballus
XP_851123 0 83.6 similar to Zinc...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037770 1.1e-79 48.7 KIAA1349
D31763 7.3e-79 46.0 KIAA0065
AB046831 4.6e-78 45.6 KIAA1611
AB075827 7.2e-75 47.1 KIAA1947
AB107355 1.2e-73 42.4 KIAA2033
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 235 258 PD000003 Zinc finger
IPR007087 291 314 PD000003 Zinc finger
IPR007087 319 342 PD000003 Zinc finger
IPR007087 347 370 PD000003 Zinc finger
IPR007087 375 398 PD000003 Zinc finger
IPR007087 403 426 PD000003 Zinc finger
IPR007087 431 454 PD000003 Zinc finger
IPR007087 459 482 PD000003 Zinc finger
IPR007087 487 510 PD000003 Zinc finger
IPR007087 515 538 PD000003 Zinc finger
IPR007087 543 566 PD000003 Zinc finger
IPR007087 571 594 PD000003 Zinc finger
IPR007087 627 650 PD000003 Zinc finger
IPR007087 655 677 PD000003 Zinc finger
HMMPfam IPR001909 38 78 PF01352 KRAB box
IPR007087 235 257 PF00096 Zinc finger
IPR007087 263 285 PF00096 Zinc finger
IPR007087 291 313 PF00096 Zinc finger
IPR007087 319 341 PF00096 Zinc finger
IPR007087 347 369 PF00096 Zinc finger
IPR007087 375 397 PF00096 Zinc finger
IPR007087 403 425 PF00096 Zinc finger
IPR007087 431 453 PF00096 Zinc finger
IPR007087 459 481 PF00096 Zinc finger
IPR007087 487 509 PF00096 Zinc finger
IPR007087 515 537 PF00096 Zinc finger
IPR007087 543 565 PF00096 Zinc finger
IPR007087 571 593 PF00096 Zinc finger
IPR007087 599 621 PF00096 Zinc finger
IPR007087 627 649 PF00096 Zinc finger
IPR007087 655 677 PF00096 Zinc finger
HMMSmart IPR001909 38 98 SM00349 KRAB box
IPR015880 235 257 SM00355 Zinc finger
IPR015880 263 285 SM00355 Zinc finger
IPR015880 291 313 SM00355 Zinc finger
IPR015880 319 341 SM00355 Zinc finger
IPR015880 347 369 SM00355 Zinc finger
IPR015880 375 397 SM00355 Zinc finger
IPR015880 403 425 SM00355 Zinc finger
IPR015880 431 453 SM00355 Zinc finger
IPR015880 459 481 SM00355 Zinc finger
IPR015880 487 509 SM00355 Zinc finger
IPR015880 515 537 SM00355 Zinc finger
IPR015880 543 565 SM00355 Zinc finger
IPR015880 571 593 SM00355 Zinc finger
IPR015880 599 621 SM00355 Zinc finger
IPR015880 627 649 SM00355 Zinc finger
IPR015880 655 677 SM00355 Zinc finger
ProfileScan IPR001909 38 109 PS50805 KRAB box
IPR007087 235 262 PS50157 Zinc finger
IPR007087 263 290 PS50157 Zinc finger
IPR007087 291 318 PS50157 Zinc finger
IPR007087 319 346 PS50157 Zinc finger
IPR007087 347 374 PS50157 Zinc finger
IPR007087 375 402 PS50157 Zinc finger
IPR007087 403 430 PS50157 Zinc finger
IPR007087 431 458 PS50157 Zinc finger
IPR007087 459 486 PS50157 Zinc finger
IPR007087 487 514 PS50157 Zinc finger
IPR007087 515 542 PS50157 Zinc finger
IPR007087 543 570 PS50157 Zinc finger
IPR007087 571 598 PS50157 Zinc finger
IPR007087 599 626 PS50157 Zinc finger
IPR007087 627 654 PS50157 Zinc finger
IPR007087 655 682 PS50157 Zinc finger
ScanRegExp IPR007087 237 257 PS00028 Zinc finger
IPR007087 265 285 PS00028 Zinc finger
IPR007087 293 313 PS00028 Zinc finger
IPR007087 321 341 PS00028 Zinc finger
IPR007087 349 369 PS00028 Zinc finger
IPR007087 377 397 PS00028 Zinc finger
IPR007087 405 425 PS00028 Zinc finger
IPR007087 433 453 PS00028 Zinc finger
IPR007087 461 481 PS00028 Zinc finger
IPR007087 489 509 PS00028 Zinc finger
IPR007087 517 537 PS00028 Zinc finger
IPR007087 545 565 PS00028 Zinc finger
IPR007087 573 593 PS00028 Zinc finger
IPR007087 599 621 PS00028 Zinc finger
IPR007087 629 649 PS00028 Zinc finger
IPR007087 657 677 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GAACTTACACATACTAGCAGC
Primer_r CATGTATCACTGAAATCCTCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f GAACTTACACATACTAGCAGC
Primer_r CATGTATCACTGAAATCCTCG
PCR product length 137 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp