Order Kazusa clone(s) from : ![]() |
Product ID | ORK00811 |
---|---|
Accession No | AB037770 |
Description | zinc finger protein 624 |
Clone name | fj00940 |
Vector information | |
cDNA sequence | DNA sequence (4055 bp) Predicted protein sequence (752 aa) |
Flexi ORF Clone | FXC00811 |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1544 bp |
---|---|
Genome contig ID | gi51511734r_16364776 |
PolyA signal sequence (ATTAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 16464776 | 16474544 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 163 | 186 | PD000003 | Zinc finger |
IPR007087 | 191 | 214 | PD000003 | Zinc finger | |
IPR007087 | 219 | 242 | PD000003 | Zinc finger | |
IPR007087 | 247 | 267 | PD000003 | Zinc finger | |
IPR007087 | 275 | 297 | PD000003 | Zinc finger | |
IPR007087 | 303 | 326 | PD000003 | Zinc finger | |
IPR007087 | 331 | 354 | PD000003 | Zinc finger | |
IPR007087 | 359 | 382 | PD000003 | Zinc finger | |
IPR007087 | 387 | 410 | PD000003 | Zinc finger | |
IPR007087 | 415 | 438 | PD000003 | Zinc finger | |
IPR007087 | 443 | 466 | PD000003 | Zinc finger | |
IPR007087 | 471 | 494 | PD000003 | Zinc finger | |
IPR007087 | 527 | 550 | PD000003 | Zinc finger | |
IPR007087 | 555 | 578 | PD000003 | Zinc finger | |
IPR007087 | 583 | 606 | PD000003 | Zinc finger | |
IPR007087 | 611 | 634 | PD000003 | Zinc finger | |
IPR007087 | 639 | 662 | PD000003 | Zinc finger | |
IPR007087 | 695 | 718 | PD000003 | Zinc finger | |
IPR007087 | 723 | 745 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 163 | 185 | PF00096 | Zinc finger |
IPR007087 | 191 | 213 | PF00096 | Zinc finger | |
IPR007087 | 219 | 241 | PF00096 | Zinc finger | |
IPR007087 | 247 | 269 | PF00096 | Zinc finger | |
IPR007087 | 275 | 297 | PF00096 | Zinc finger | |
IPR007087 | 303 | 325 | PF00096 | Zinc finger | |
IPR007087 | 331 | 353 | PF00096 | Zinc finger | |
IPR007087 | 359 | 381 | PF00096 | Zinc finger | |
IPR007087 | 387 | 409 | PF00096 | Zinc finger | |
IPR007087 | 415 | 437 | PF00096 | Zinc finger | |
IPR007087 | 443 | 465 | PF00096 | Zinc finger | |
IPR007087 | 471 | 493 | PF00096 | Zinc finger | |
IPR007087 | 499 | 521 | PF00096 | Zinc finger | |
IPR007087 | 527 | 549 | PF00096 | Zinc finger | |
IPR007087 | 555 | 577 | PF00096 | Zinc finger | |
IPR007087 | 583 | 605 | PF00096 | Zinc finger | |
IPR007087 | 611 | 633 | PF00096 | Zinc finger | |
IPR007087 | 639 | 661 | PF00096 | Zinc finger | |
IPR007087 | 667 | 689 | PF00096 | Zinc finger | |
IPR007087 | 695 | 717 | PF00096 | Zinc finger | |
IPR007087 | 723 | 745 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 163 | 185 | SM00355 | Zinc finger |
IPR015880 | 191 | 213 | SM00355 | Zinc finger | |
IPR015880 | 219 | 241 | SM00355 | Zinc finger | |
IPR015880 | 247 | 267 | SM00355 | Zinc finger | |
IPR015880 | 275 | 297 | SM00355 | Zinc finger | |
IPR015880 | 303 | 325 | SM00355 | Zinc finger | |
IPR015880 | 331 | 353 | SM00355 | Zinc finger | |
IPR015880 | 359 | 381 | SM00355 | Zinc finger | |
IPR015880 | 387 | 409 | SM00355 | Zinc finger | |
IPR015880 | 415 | 437 | SM00355 | Zinc finger | |
IPR015880 | 443 | 465 | SM00355 | Zinc finger | |
IPR015880 | 471 | 493 | SM00355 | Zinc finger | |
IPR015880 | 499 | 521 | SM00355 | Zinc finger | |
IPR015880 | 527 | 549 | SM00355 | Zinc finger | |
IPR015880 | 555 | 577 | SM00355 | Zinc finger | |
IPR015880 | 583 | 605 | SM00355 | Zinc finger | |
IPR015880 | 611 | 633 | SM00355 | Zinc finger | |
IPR015880 | 639 | 661 | SM00355 | Zinc finger | |
IPR015880 | 667 | 689 | SM00355 | Zinc finger | |
IPR015880 | 695 | 717 | SM00355 | Zinc finger | |
IPR015880 | 723 | 745 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 163 | 190 | PS50157 | Zinc finger |
IPR007087 | 191 | 218 | PS50157 | Zinc finger | |
IPR007087 | 219 | 246 | PS50157 | Zinc finger | |
IPR007087 | 247 | 274 | PS50157 | Zinc finger | |
IPR007087 | 275 | 302 | PS50157 | Zinc finger | |
IPR007087 | 303 | 330 | PS50157 | Zinc finger | |
IPR007087 | 331 | 358 | PS50157 | Zinc finger | |
IPR007087 | 359 | 386 | PS50157 | Zinc finger | |
IPR007087 | 387 | 414 | PS50157 | Zinc finger | |
IPR007087 | 415 | 442 | PS50157 | Zinc finger | |
IPR007087 | 443 | 470 | PS50157 | Zinc finger | |
IPR007087 | 471 | 498 | PS50157 | Zinc finger | |
IPR007087 | 499 | 526 | PS50157 | Zinc finger | |
IPR007087 | 527 | 554 | PS50157 | Zinc finger | |
IPR007087 | 555 | 582 | PS50157 | Zinc finger | |
IPR007087 | 583 | 610 | PS50157 | Zinc finger | |
IPR007087 | 611 | 638 | PS50157 | Zinc finger | |
IPR007087 | 639 | 666 | PS50157 | Zinc finger | |
IPR007087 | 667 | 694 | PS50157 | Zinc finger | |
IPR007087 | 695 | 722 | PS50157 | Zinc finger | |
IPR007087 | 723 | 750 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 165 | 185 | PS00028 | Zinc finger |
IPR007087 | 193 | 213 | PS00028 | Zinc finger | |
IPR007087 | 221 | 241 | PS00028 | Zinc finger | |
IPR007087 | 277 | 297 | PS00028 | Zinc finger | |
IPR007087 | 305 | 325 | PS00028 | Zinc finger | |
IPR007087 | 333 | 353 | PS00028 | Zinc finger | |
IPR007087 | 361 | 381 | PS00028 | Zinc finger | |
IPR007087 | 389 | 409 | PS00028 | Zinc finger | |
IPR007087 | 417 | 437 | PS00028 | Zinc finger | |
IPR007087 | 445 | 465 | PS00028 | Zinc finger | |
IPR007087 | 473 | 493 | PS00028 | Zinc finger | |
IPR007087 | 501 | 521 | PS00028 | Zinc finger | |
IPR007087 | 529 | 549 | PS00028 | Zinc finger | |
IPR007087 | 557 | 577 | PS00028 | Zinc finger | |
IPR007087 | 585 | 605 | PS00028 | Zinc finger | |
IPR007087 | 613 | 633 | PS00028 | Zinc finger | |
IPR007087 | 641 | 661 | PS00028 | Zinc finger | |
IPR007087 | 669 | 689 | PS00028 | Zinc finger | |
IPR007087 | 697 | 717 | PS00028 | Zinc finger | |
IPR007087 | 725 | 745 | PS00028 | Zinc finger |
![]() |
Primer_f | GCCTCCCTTAACCCTACCTTC |
---|---|
Primer_r | CCTAAGCTGGGGCAATCTCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCCTCCCTTAACCCTACCTTC |
Primer_r | CCTAAGCTGGGGCAATCTCAC |
PCR product length | 128 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |