Gene/Protein Characteristic Table for KIAA1611
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK02042
Accession No AB046831
Description zinc finger protein 160, transcript variant 1
Clone name fj12627
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4688 bp)
Predicted protein sequence (813 aa)
Flexi ORF Clone FXC02042
Source Human fetal brain
Rouge ID mKIAA1611 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4688 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 58261680 58271032 3 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 813 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9HCG1 0 100.0 Zinc finger pro...
Homo sapiens
AAH94880 0 99.9 Zinc finger pro...
Homo sapiens
XP_001116710 0 97.9 zinc finger pro...
Macaca mulatta
EAW72111 0 99.9 zinc finger pro...
Homo sapiens
XP_001116703 0 98.1 zinc finger pro...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037770 1.3e-117 51.6 KIAA1349
AB075862 3.6e-112 58.3 KIAA1982
AB107355 3.7e-108 53.1 KIAA2033
AB058730 3.5e-95 61.8 KIAA1827
D31763 4.1e-95 44.2 KIAA0065
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 252 275 PD000003 Zinc finger
IPR007087 280 303 PD000003 Zinc finger
IPR007087 308 331 PD000003 Zinc finger
IPR007087 336 359 PD000003 Zinc finger
IPR007087 364 387 PD000003 Zinc finger
IPR007087 392 415 PD000003 Zinc finger
IPR007087 420 443 PD000003 Zinc finger
IPR007087 448 471 PD000003 Zinc finger
IPR007087 476 499 PD000003 Zinc finger
IPR007087 504 527 PD000003 Zinc finger
IPR007087 532 555 PD000003 Zinc finger
IPR007087 560 583 PD000003 Zinc finger
IPR007087 588 611 PD000003 Zinc finger
IPR007087 616 639 PD000003 Zinc finger
IPR007087 644 667 PD000003 Zinc finger
IPR007087 672 695 PD000003 Zinc finger
IPR007087 700 723 PD000003 Zinc finger
IPR007087 728 751 PD000003 Zinc finger
IPR007087 756 779 PD000003 Zinc finger
IPR007087 784 807 PD000003 Zinc finger
HMMPfam IPR001909 3 43 PF01352 KRAB box
IPR007087 252 274 PF00096 Zinc finger
IPR007087 280 302 PF00096 Zinc finger
IPR007087 308 330 PF00096 Zinc finger
IPR007087 336 358 PF00096 Zinc finger
IPR007087 364 386 PF00096 Zinc finger
IPR007087 392 414 PF00096 Zinc finger
IPR007087 420 442 PF00096 Zinc finger
IPR007087 448 470 PF00096 Zinc finger
IPR007087 476 498 PF00096 Zinc finger
IPR007087 504 526 PF00096 Zinc finger
IPR007087 532 554 PF00096 Zinc finger
IPR007087 560 582 PF00096 Zinc finger
IPR007087 588 610 PF00096 Zinc finger
IPR007087 616 638 PF00096 Zinc finger
IPR007087 644 666 PF00096 Zinc finger
IPR007087 672 694 PF00096 Zinc finger
IPR007087 700 722 PF00096 Zinc finger
IPR007087 728 750 PF00096 Zinc finger
IPR007087 756 778 PF00096 Zinc finger
IPR007087 784 806 PF00096 Zinc finger
HMMSmart IPR001909 3 63 SM00349 KRAB box
IPR015880 252 274 SM00355 Zinc finger
IPR015880 280 302 SM00355 Zinc finger
IPR015880 308 330 SM00355 Zinc finger
IPR015880 336 358 SM00355 Zinc finger
IPR015880 364 386 SM00355 Zinc finger
IPR015880 392 414 SM00355 Zinc finger
IPR015880 420 442 SM00355 Zinc finger
IPR015880 448 470 SM00355 Zinc finger
IPR015880 476 498 SM00355 Zinc finger
IPR015880 504 526 SM00355 Zinc finger
IPR015880 532 554 SM00355 Zinc finger
IPR015880 560 582 SM00355 Zinc finger
IPR015880 588 610 SM00355 Zinc finger
IPR015880 616 638 SM00355 Zinc finger
IPR015880 644 666 SM00355 Zinc finger
IPR015880 672 694 SM00355 Zinc finger
IPR015880 700 722 SM00355 Zinc finger
IPR015880 728 750 SM00355 Zinc finger
IPR015880 756 778 SM00355 Zinc finger
IPR015880 784 806 SM00355 Zinc finger
ProfileScan IPR001909 3 74 PS50805 KRAB box
IPR007087 252 279 PS50157 Zinc finger
IPR007087 280 307 PS50157 Zinc finger
IPR007087 308 335 PS50157 Zinc finger
IPR007087 336 363 PS50157 Zinc finger
IPR007087 364 391 PS50157 Zinc finger
IPR007087 392 419 PS50157 Zinc finger
IPR007087 420 447 PS50157 Zinc finger
IPR007087 448 475 PS50157 Zinc finger
IPR007087 476 503 PS50157 Zinc finger
IPR007087 504 531 PS50157 Zinc finger
IPR007087 532 559 PS50157 Zinc finger
IPR007087 560 587 PS50157 Zinc finger
IPR007087 588 615 PS50157 Zinc finger
IPR007087 616 643 PS50157 Zinc finger
IPR007087 644 671 PS50157 Zinc finger
IPR007087 672 699 PS50157 Zinc finger
IPR007087 700 727 PS50157 Zinc finger
IPR007087 728 755 PS50157 Zinc finger
IPR007087 756 783 PS50157 Zinc finger
IPR007087 784 811 PS50157 Zinc finger
ScanRegExp IPR007087 254 274 PS00028 Zinc finger
IPR007087 282 302 PS00028 Zinc finger
IPR007087 310 330 PS00028 Zinc finger
IPR007087 338 358 PS00028 Zinc finger
IPR007087 366 386 PS00028 Zinc finger
IPR007087 394 414 PS00028 Zinc finger
IPR007087 422 442 PS00028 Zinc finger
IPR007087 450 470 PS00028 Zinc finger
IPR007087 478 498 PS00028 Zinc finger
IPR007087 506 526 PS00028 Zinc finger
IPR007087 534 554 PS00028 Zinc finger
IPR007087 562 582 PS00028 Zinc finger
IPR007087 590 610 PS00028 Zinc finger
IPR007087 618 638 PS00028 Zinc finger
IPR007087 646 666 PS00028 Zinc finger
IPR007087 674 694 PS00028 Zinc finger
IPR007087 702 722 PS00028 Zinc finger
IPR007087 730 750 PS00028 Zinc finger
IPR007087 758 778 PS00028 Zinc finger
IPR007087 786 806 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AAGGCGTGGTCACAGATATCC
Primer_r TCCTGTGTCATCTCTCCATTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp