Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK02042 |
---|---|
Accession No | AB046831 |
Description | zinc finger protein 160, transcript variant 1 |
Clone name | fj12627 |
Vector information | |
cDNA sequence | DNA sequence (4688 bp) Predicted protein sequence (813 aa) |
HaloTag ORF Clone |
FHC02042
|
Flexi ORF Clone | FXC02042 |
Source | Human fetal brain |
Rouge ID |
mKIAA1611
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 58261680 | 58271032 | 3 | 99.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 252 | 275 | PD000003 | Zinc finger |
IPR007087 | 280 | 303 | PD000003 | Zinc finger | |
IPR007087 | 308 | 331 | PD000003 | Zinc finger | |
IPR007087 | 336 | 359 | PD000003 | Zinc finger | |
IPR007087 | 364 | 387 | PD000003 | Zinc finger | |
IPR007087 | 392 | 415 | PD000003 | Zinc finger | |
IPR007087 | 420 | 443 | PD000003 | Zinc finger | |
IPR007087 | 448 | 471 | PD000003 | Zinc finger | |
IPR007087 | 476 | 499 | PD000003 | Zinc finger | |
IPR007087 | 504 | 527 | PD000003 | Zinc finger | |
IPR007087 | 532 | 555 | PD000003 | Zinc finger | |
IPR007087 | 560 | 583 | PD000003 | Zinc finger | |
IPR007087 | 588 | 611 | PD000003 | Zinc finger | |
IPR007087 | 616 | 639 | PD000003 | Zinc finger | |
IPR007087 | 644 | 667 | PD000003 | Zinc finger | |
IPR007087 | 672 | 695 | PD000003 | Zinc finger | |
IPR007087 | 700 | 723 | PD000003 | Zinc finger | |
IPR007087 | 728 | 751 | PD000003 | Zinc finger | |
IPR007087 | 756 | 779 | PD000003 | Zinc finger | |
IPR007087 | 784 | 807 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 3 | 43 | PF01352 | KRAB box |
IPR007087 | 252 | 274 | PF00096 | Zinc finger | |
IPR007087 | 280 | 302 | PF00096 | Zinc finger | |
IPR007087 | 308 | 330 | PF00096 | Zinc finger | |
IPR007087 | 336 | 358 | PF00096 | Zinc finger | |
IPR007087 | 364 | 386 | PF00096 | Zinc finger | |
IPR007087 | 392 | 414 | PF00096 | Zinc finger | |
IPR007087 | 420 | 442 | PF00096 | Zinc finger | |
IPR007087 | 448 | 470 | PF00096 | Zinc finger | |
IPR007087 | 476 | 498 | PF00096 | Zinc finger | |
IPR007087 | 504 | 526 | PF00096 | Zinc finger | |
IPR007087 | 532 | 554 | PF00096 | Zinc finger | |
IPR007087 | 560 | 582 | PF00096 | Zinc finger | |
IPR007087 | 588 | 610 | PF00096 | Zinc finger | |
IPR007087 | 616 | 638 | PF00096 | Zinc finger | |
IPR007087 | 644 | 666 | PF00096 | Zinc finger | |
IPR007087 | 672 | 694 | PF00096 | Zinc finger | |
IPR007087 | 700 | 722 | PF00096 | Zinc finger | |
IPR007087 | 728 | 750 | PF00096 | Zinc finger | |
IPR007087 | 756 | 778 | PF00096 | Zinc finger | |
IPR007087 | 784 | 806 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 3 | 63 | SM00349 | KRAB box |
IPR015880 | 252 | 274 | SM00355 | Zinc finger | |
IPR015880 | 280 | 302 | SM00355 | Zinc finger | |
IPR015880 | 308 | 330 | SM00355 | Zinc finger | |
IPR015880 | 336 | 358 | SM00355 | Zinc finger | |
IPR015880 | 364 | 386 | SM00355 | Zinc finger | |
IPR015880 | 392 | 414 | SM00355 | Zinc finger | |
IPR015880 | 420 | 442 | SM00355 | Zinc finger | |
IPR015880 | 448 | 470 | SM00355 | Zinc finger | |
IPR015880 | 476 | 498 | SM00355 | Zinc finger | |
IPR015880 | 504 | 526 | SM00355 | Zinc finger | |
IPR015880 | 532 | 554 | SM00355 | Zinc finger | |
IPR015880 | 560 | 582 | SM00355 | Zinc finger | |
IPR015880 | 588 | 610 | SM00355 | Zinc finger | |
IPR015880 | 616 | 638 | SM00355 | Zinc finger | |
IPR015880 | 644 | 666 | SM00355 | Zinc finger | |
IPR015880 | 672 | 694 | SM00355 | Zinc finger | |
IPR015880 | 700 | 722 | SM00355 | Zinc finger | |
IPR015880 | 728 | 750 | SM00355 | Zinc finger | |
IPR015880 | 756 | 778 | SM00355 | Zinc finger | |
IPR015880 | 784 | 806 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 3 | 74 | PS50805 | KRAB box |
IPR007087 | 252 | 279 | PS50157 | Zinc finger | |
IPR007087 | 280 | 307 | PS50157 | Zinc finger | |
IPR007087 | 308 | 335 | PS50157 | Zinc finger | |
IPR007087 | 336 | 363 | PS50157 | Zinc finger | |
IPR007087 | 364 | 391 | PS50157 | Zinc finger | |
IPR007087 | 392 | 419 | PS50157 | Zinc finger | |
IPR007087 | 420 | 447 | PS50157 | Zinc finger | |
IPR007087 | 448 | 475 | PS50157 | Zinc finger | |
IPR007087 | 476 | 503 | PS50157 | Zinc finger | |
IPR007087 | 504 | 531 | PS50157 | Zinc finger | |
IPR007087 | 532 | 559 | PS50157 | Zinc finger | |
IPR007087 | 560 | 587 | PS50157 | Zinc finger | |
IPR007087 | 588 | 615 | PS50157 | Zinc finger | |
IPR007087 | 616 | 643 | PS50157 | Zinc finger | |
IPR007087 | 644 | 671 | PS50157 | Zinc finger | |
IPR007087 | 672 | 699 | PS50157 | Zinc finger | |
IPR007087 | 700 | 727 | PS50157 | Zinc finger | |
IPR007087 | 728 | 755 | PS50157 | Zinc finger | |
IPR007087 | 756 | 783 | PS50157 | Zinc finger | |
IPR007087 | 784 | 811 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 254 | 274 | PS00028 | Zinc finger |
IPR007087 | 282 | 302 | PS00028 | Zinc finger | |
IPR007087 | 310 | 330 | PS00028 | Zinc finger | |
IPR007087 | 338 | 358 | PS00028 | Zinc finger | |
IPR007087 | 366 | 386 | PS00028 | Zinc finger | |
IPR007087 | 394 | 414 | PS00028 | Zinc finger | |
IPR007087 | 422 | 442 | PS00028 | Zinc finger | |
IPR007087 | 450 | 470 | PS00028 | Zinc finger | |
IPR007087 | 478 | 498 | PS00028 | Zinc finger | |
IPR007087 | 506 | 526 | PS00028 | Zinc finger | |
IPR007087 | 534 | 554 | PS00028 | Zinc finger | |
IPR007087 | 562 | 582 | PS00028 | Zinc finger | |
IPR007087 | 590 | 610 | PS00028 | Zinc finger | |
IPR007087 | 618 | 638 | PS00028 | Zinc finger | |
IPR007087 | 646 | 666 | PS00028 | Zinc finger | |
IPR007087 | 674 | 694 | PS00028 | Zinc finger | |
IPR007087 | 702 | 722 | PS00028 | Zinc finger | |
IPR007087 | 730 | 750 | PS00028 | Zinc finger | |
IPR007087 | 758 | 778 | PS00028 | Zinc finger | |
IPR007087 | 786 | 806 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | AAGGCGTGGTCACAGATATCC |
---|---|
Primer_r | TCCTGTGTCATCTCTCCATTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |