Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00392 |
---|---|
Accession No | D31763 |
Description | zinc finger protein 33A, transcript variant 2 |
Clone name | ha00946 |
Vector information | |
cDNA sequence | DNA sequence (6041 bp) Predicted protein sequence (848 aa) |
HaloTag ORF Clone |
FHC00392
|
Flexi ORF Clone | FXC00392 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 366 | 389 | PD000003 | Zinc finger |
IPR007087 | 394 | 417 | PD000003 | Zinc finger | |
IPR007087 | 422 | 445 | PD000003 | Zinc finger | |
IPR007087 | 450 | 473 | PD000003 | Zinc finger | |
IPR007087 | 478 | 501 | PD000003 | Zinc finger | |
IPR007087 | 506 | 528 | PD000003 | Zinc finger | |
IPR007087 | 534 | 557 | PD000003 | Zinc finger | |
IPR007087 | 562 | 585 | PD000003 | Zinc finger | |
IPR007087 | 590 | 613 | PD000003 | Zinc finger | |
IPR007087 | 618 | 641 | PD000003 | Zinc finger | |
IPR007087 | 646 | 668 | PD000003 | Zinc finger | |
IPR007087 | 674 | 697 | PD000003 | Zinc finger | |
IPR007087 | 702 | 725 | PD000003 | Zinc finger | |
IPR007087 | 730 | 753 | PD000003 | Zinc finger | |
IPR007087 | 760 | 781 | PD000003 | Zinc finger | |
IPR007087 | 786 | 808 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 50 | 90 | PF01352 | KRAB box |
IPR007087 | 366 | 388 | PF00096 | Zinc finger | |
IPR007087 | 394 | 416 | PF00096 | Zinc finger | |
IPR007087 | 422 | 444 | PF00096 | Zinc finger | |
IPR007087 | 450 | 472 | PF00096 | Zinc finger | |
IPR007087 | 478 | 500 | PF00096 | Zinc finger | |
IPR007087 | 506 | 528 | PF00096 | Zinc finger | |
IPR007087 | 534 | 556 | PF00096 | Zinc finger | |
IPR007087 | 562 | 584 | PF00096 | Zinc finger | |
IPR007087 | 590 | 612 | PF00096 | Zinc finger | |
IPR007087 | 618 | 640 | PF00096 | Zinc finger | |
IPR007087 | 646 | 668 | PF00096 | Zinc finger | |
IPR007087 | 674 | 696 | PF00096 | Zinc finger | |
IPR007087 | 702 | 724 | PF00096 | Zinc finger | |
IPR007087 | 730 | 752 | PF00096 | Zinc finger | |
IPR007087 | 758 | 780 | PF00096 | Zinc finger | |
IPR007087 | 786 | 808 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 50 | 110 | SM00349 | KRAB box |
IPR015880 | 366 | 388 | SM00355 | Zinc finger | |
IPR015880 | 394 | 416 | SM00355 | Zinc finger | |
IPR015880 | 422 | 444 | SM00355 | Zinc finger | |
IPR015880 | 450 | 472 | SM00355 | Zinc finger | |
IPR015880 | 478 | 500 | SM00355 | Zinc finger | |
IPR015880 | 506 | 528 | SM00355 | Zinc finger | |
IPR015880 | 534 | 556 | SM00355 | Zinc finger | |
IPR015880 | 562 | 584 | SM00355 | Zinc finger | |
IPR015880 | 590 | 612 | SM00355 | Zinc finger | |
IPR015880 | 618 | 640 | SM00355 | Zinc finger | |
IPR015880 | 646 | 668 | SM00355 | Zinc finger | |
IPR015880 | 674 | 696 | SM00355 | Zinc finger | |
IPR015880 | 702 | 724 | SM00355 | Zinc finger | |
IPR015880 | 730 | 752 | SM00355 | Zinc finger | |
IPR015880 | 758 | 780 | SM00355 | Zinc finger | |
IPR015880 | 786 | 808 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 50 | 121 | PS50805 | KRAB box |
IPR007087 | 366 | 393 | PS50157 | Zinc finger | |
IPR007087 | 394 | 421 | PS50157 | Zinc finger | |
IPR007087 | 422 | 449 | PS50157 | Zinc finger | |
IPR007087 | 450 | 477 | PS50157 | Zinc finger | |
IPR007087 | 478 | 505 | PS50157 | Zinc finger | |
IPR007087 | 506 | 533 | PS50157 | Zinc finger | |
IPR007087 | 534 | 561 | PS50157 | Zinc finger | |
IPR007087 | 562 | 589 | PS50157 | Zinc finger | |
IPR007087 | 590 | 617 | PS50157 | Zinc finger | |
IPR007087 | 618 | 645 | PS50157 | Zinc finger | |
IPR007087 | 646 | 673 | PS50157 | Zinc finger | |
IPR007087 | 674 | 701 | PS50157 | Zinc finger | |
IPR007087 | 702 | 729 | PS50157 | Zinc finger | |
IPR007087 | 730 | 757 | PS50157 | Zinc finger | |
IPR007087 | 758 | 785 | PS50157 | Zinc finger | |
IPR007087 | 786 | 813 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 368 | 388 | PS00028 | Zinc finger |
IPR007087 | 396 | 416 | PS00028 | Zinc finger | |
IPR007087 | 424 | 444 | PS00028 | Zinc finger | |
IPR007087 | 452 | 472 | PS00028 | Zinc finger | |
IPR007087 | 480 | 500 | PS00028 | Zinc finger | |
IPR007087 | 508 | 528 | PS00028 | Zinc finger | |
IPR007087 | 536 | 556 | PS00028 | Zinc finger | |
IPR007087 | 564 | 584 | PS00028 | Zinc finger | |
IPR007087 | 592 | 612 | PS00028 | Zinc finger | |
IPR007087 | 620 | 640 | PS00028 | Zinc finger | |
IPR007087 | 648 | 668 | PS00028 | Zinc finger | |
IPR007087 | 676 | 696 | PS00028 | Zinc finger | |
IPR007087 | 704 | 724 | PS00028 | Zinc finger | |
IPR007087 | 732 | 752 | PS00028 | Zinc finger | |
IPR007087 | 758 | 780 | PS00028 | Zinc finger | |
IPR007087 | 788 | 808 | PS00028 | Zinc finger |
Panel name | Genebridge 4 |
---|---|
Primer_f | GAGAATGGAAAACAGTGAACG |
Primer_r | CTTCCACAGGCTCCCCAATCA |
PCR product length | 151 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |