Order Kazusa clone(s) from : ![]() |
Product ID | ORK07457 |
---|---|
Accession No | AB046808 |
Description | zinc finger protein 317, transcript variant 1 |
Clone name | fj08823 |
Vector information | |
cDNA sequence | DNA sequence (3843 bp) Predicted protein sequence (613 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1588
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 9127611 | 9135082 | 6 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 240 | 263 | PD000003 | Zinc finger |
IPR007087 | 268 | 290 | PD000003 | Zinc finger | |
IPR007087 | 324 | 347 | PD000003 | Zinc finger | |
IPR007087 | 352 | 375 | PD000003 | Zinc finger | |
IPR007087 | 437 | 459 | PD000003 | Zinc finger | |
IPR007087 | 464 | 487 | PD000003 | Zinc finger | |
IPR007087 | 521 | 543 | PD000003 | Zinc finger | |
IPR007087 | 548 | 571 | PD000003 | Zinc finger | |
IPR007087 | 576 | 598 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 75 | 115 | PF01352 | KRAB box |
IPR007087 | 240 | 262 | PF00096 | Zinc finger | |
IPR007087 | 268 | 290 | PF00096 | Zinc finger | |
IPR007087 | 296 | 318 | PF00096 | Zinc finger | |
IPR007087 | 324 | 346 | PF00096 | Zinc finger | |
IPR007087 | 352 | 374 | PF00096 | Zinc finger | |
IPR007087 | 380 | 402 | PF00096 | Zinc finger | |
IPR007087 | 408 | 430 | PF00096 | Zinc finger | |
IPR007087 | 436 | 458 | PF00096 | Zinc finger | |
IPR007087 | 464 | 486 | PF00096 | Zinc finger | |
IPR007087 | 492 | 514 | PF00096 | Zinc finger | |
IPR007087 | 520 | 542 | PF00096 | Zinc finger | |
IPR007087 | 548 | 570 | PF00096 | Zinc finger | |
IPR007087 | 576 | 598 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 75 | 135 | SM00349 | KRAB box |
IPR015880 | 240 | 262 | SM00355 | Zinc finger | |
IPR015880 | 268 | 290 | SM00355 | Zinc finger | |
IPR015880 | 296 | 318 | SM00355 | Zinc finger | |
IPR015880 | 324 | 346 | SM00355 | Zinc finger | |
IPR015880 | 352 | 374 | SM00355 | Zinc finger | |
IPR015880 | 380 | 402 | SM00355 | Zinc finger | |
IPR015880 | 408 | 430 | SM00355 | Zinc finger | |
IPR015880 | 436 | 458 | SM00355 | Zinc finger | |
IPR015880 | 464 | 486 | SM00355 | Zinc finger | |
IPR015880 | 492 | 514 | SM00355 | Zinc finger | |
IPR015880 | 520 | 542 | SM00355 | Zinc finger | |
IPR015880 | 548 | 570 | SM00355 | Zinc finger | |
IPR015880 | 576 | 598 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 75 | 146 | PS50805 | KRAB box |
IPR007087 | 240 | 267 | PS50157 | Zinc finger | |
IPR007087 | 268 | 295 | PS50157 | Zinc finger | |
IPR007087 | 296 | 323 | PS50157 | Zinc finger | |
IPR007087 | 324 | 351 | PS50157 | Zinc finger | |
IPR007087 | 352 | 379 | PS50157 | Zinc finger | |
IPR007087 | 380 | 407 | PS50157 | Zinc finger | |
IPR007087 | 408 | 435 | PS50157 | Zinc finger | |
IPR007087 | 436 | 463 | PS50157 | Zinc finger | |
IPR007087 | 464 | 491 | PS50157 | Zinc finger | |
IPR007087 | 492 | 519 | PS50157 | Zinc finger | |
IPR007087 | 520 | 547 | PS50157 | Zinc finger | |
IPR007087 | 548 | 575 | PS50157 | Zinc finger | |
IPR007087 | 576 | 603 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 242 | 262 | PS00028 | Zinc finger |
IPR007087 | 270 | 290 | PS00028 | Zinc finger | |
IPR007087 | 298 | 318 | PS00028 | Zinc finger | |
IPR007087 | 326 | 346 | PS00028 | Zinc finger | |
IPR007087 | 354 | 374 | PS00028 | Zinc finger | |
IPR007087 | 382 | 402 | PS00028 | Zinc finger | |
IPR007087 | 410 | 430 | PS00028 | Zinc finger | |
IPR007087 | 438 | 458 | PS00028 | Zinc finger | |
IPR007087 | 466 | 486 | PS00028 | Zinc finger | |
IPR007087 | 494 | 514 | PS00028 | Zinc finger | |
IPR007087 | 522 | 542 | PS00028 | Zinc finger | |
IPR007087 | 550 | 570 | PS00028 | Zinc finger | |
IPR007087 | 578 | 598 | PS00028 | Zinc finger |
![]() |
Primer_f | ACGTGAGAGCAAGAGAGTAGC |
---|---|
Primer_r | ACGAACAGGTCCAAATTCTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |