Gene/Protein Characteristic Table for KIAA1588
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07457
Accession No AB046808
Description zinc finger protein 317, transcript variant 1
Clone name fj08823
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3843 bp)
Predicted protein sequence (613 aa)
Source Human fetal brain
Rouge ID mKIAA1588 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3843 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 9127611 9135082 6 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 613 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH78154 0 100.0 Zinc finger pro...
Homo sapiens
BAG37145 0 99.8 unnamed protein...
Homo sapiens
Q96PQ6 0 99.8 Zinc finger pro...
Homo sapiens
BAG51752 0 99.8 unnamed protein...
Homo sapiens
XP_524096 0 99.2 zinc finger pro...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046779 3.1e-68 44.9 KIAA1559
AB046831 4.4e-63 47.1 KIAA1611
AB058755 1.2e-62 46.0 KIAA1852
AB075827 8e-62 46.1 KIAA1947
AB075862 1.3e-61 45.4 KIAA1982
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 240 263 PD000003 Zinc finger
IPR007087 268 290 PD000003 Zinc finger
IPR007087 324 347 PD000003 Zinc finger
IPR007087 352 375 PD000003 Zinc finger
IPR007087 437 459 PD000003 Zinc finger
IPR007087 464 487 PD000003 Zinc finger
IPR007087 521 543 PD000003 Zinc finger
IPR007087 548 571 PD000003 Zinc finger
IPR007087 576 598 PD000003 Zinc finger
HMMPfam IPR001909 75 115 PF01352 KRAB box
IPR007087 240 262 PF00096 Zinc finger
IPR007087 268 290 PF00096 Zinc finger
IPR007087 296 318 PF00096 Zinc finger
IPR007087 324 346 PF00096 Zinc finger
IPR007087 352 374 PF00096 Zinc finger
IPR007087 380 402 PF00096 Zinc finger
IPR007087 408 430 PF00096 Zinc finger
IPR007087 436 458 PF00096 Zinc finger
IPR007087 464 486 PF00096 Zinc finger
IPR007087 492 514 PF00096 Zinc finger
IPR007087 520 542 PF00096 Zinc finger
IPR007087 548 570 PF00096 Zinc finger
IPR007087 576 598 PF00096 Zinc finger
HMMSmart IPR001909 75 135 SM00349 KRAB box
IPR015880 240 262 SM00355 Zinc finger
IPR015880 268 290 SM00355 Zinc finger
IPR015880 296 318 SM00355 Zinc finger
IPR015880 324 346 SM00355 Zinc finger
IPR015880 352 374 SM00355 Zinc finger
IPR015880 380 402 SM00355 Zinc finger
IPR015880 408 430 SM00355 Zinc finger
IPR015880 436 458 SM00355 Zinc finger
IPR015880 464 486 SM00355 Zinc finger
IPR015880 492 514 SM00355 Zinc finger
IPR015880 520 542 SM00355 Zinc finger
IPR015880 548 570 SM00355 Zinc finger
IPR015880 576 598 SM00355 Zinc finger
ProfileScan IPR001909 75 146 PS50805 KRAB box
IPR007087 240 267 PS50157 Zinc finger
IPR007087 268 295 PS50157 Zinc finger
IPR007087 296 323 PS50157 Zinc finger
IPR007087 324 351 PS50157 Zinc finger
IPR007087 352 379 PS50157 Zinc finger
IPR007087 380 407 PS50157 Zinc finger
IPR007087 408 435 PS50157 Zinc finger
IPR007087 436 463 PS50157 Zinc finger
IPR007087 464 491 PS50157 Zinc finger
IPR007087 492 519 PS50157 Zinc finger
IPR007087 520 547 PS50157 Zinc finger
IPR007087 548 575 PS50157 Zinc finger
IPR007087 576 603 PS50157 Zinc finger
ScanRegExp IPR007087 242 262 PS00028 Zinc finger
IPR007087 270 290 PS00028 Zinc finger
IPR007087 298 318 PS00028 Zinc finger
IPR007087 326 346 PS00028 Zinc finger
IPR007087 354 374 PS00028 Zinc finger
IPR007087 382 402 PS00028 Zinc finger
IPR007087 410 430 PS00028 Zinc finger
IPR007087 438 458 PS00028 Zinc finger
IPR007087 466 486 PS00028 Zinc finger
IPR007087 494 514 PS00028 Zinc finger
IPR007087 522 542 PS00028 Zinc finger
IPR007087 550 570 PS00028 Zinc finger
IPR007087 578 598 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACGTGAGAGCAAGAGAGTAGC
Primer_r ACGAACAGGTCCAAATTCTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp