Order Kazusa clone(s) from : ![]() |
Product ID | ORK00863 |
---|---|
Accession No | AB046779 |
Description | ZFP14 zinc finger protein, transcript variant 2 |
Clone name | fh19195 |
Vector information | |
cDNA sequence | DNA sequence (5659 bp) Predicted protein sequence (544 aa) |
HaloTag ORF Clone |
FHC00863
![]() |
Flexi ORF Clone | FXC00863 |
Source | Human fetal brain |
Rouge ID |
mKIAA1559
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3964 bp |
---|---|
Genome contig ID | gi42406306r_41419281 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99721 - 99672) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 41519002 | 41550715 | 4 | 99.1 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 183 | 206 | PD000003 | Zinc finger |
IPR007087 | 211 | 234 | PD000003 | Zinc finger | |
IPR007087 | 239 | 262 | PD000003 | Zinc finger | |
IPR007087 | 267 | 290 | PD000003 | Zinc finger | |
IPR007087 | 295 | 318 | PD000003 | Zinc finger | |
IPR007087 | 323 | 345 | PD000003 | Zinc finger | |
IPR007087 | 351 | 374 | PD000003 | Zinc finger | |
IPR007087 | 379 | 402 | PD000003 | Zinc finger | |
IPR007087 | 407 | 429 | PD000003 | Zinc finger | |
IPR007087 | 435 | 458 | PD000003 | Zinc finger | |
IPR007087 | 463 | 486 | PD000003 | Zinc finger | |
IPR007087 | 491 | 514 | PD000003 | Zinc finger | |
IPR007087 | 519 | 542 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 17 | 57 | PF01352 | KRAB box |
IPR007087 | 183 | 205 | PF00096 | Zinc finger | |
IPR007087 | 211 | 233 | PF00096 | Zinc finger | |
IPR007087 | 239 | 261 | PF00096 | Zinc finger | |
IPR007087 | 267 | 289 | PF00096 | Zinc finger | |
IPR007087 | 295 | 317 | PF00096 | Zinc finger | |
IPR007087 | 323 | 345 | PF00096 | Zinc finger | |
IPR007087 | 351 | 373 | PF00096 | Zinc finger | |
IPR007087 | 379 | 401 | PF00096 | Zinc finger | |
IPR007087 | 407 | 429 | PF00096 | Zinc finger | |
IPR007087 | 435 | 457 | PF00096 | Zinc finger | |
IPR007087 | 463 | 485 | PF00096 | Zinc finger | |
IPR007087 | 491 | 513 | PF00096 | Zinc finger | |
IPR007087 | 519 | 541 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 17 | 78 | SM00349 | KRAB box |
IPR015880 | 183 | 205 | SM00355 | Zinc finger | |
IPR015880 | 211 | 233 | SM00355 | Zinc finger | |
IPR015880 | 239 | 261 | SM00355 | Zinc finger | |
IPR015880 | 267 | 289 | SM00355 | Zinc finger | |
IPR015880 | 295 | 317 | SM00355 | Zinc finger | |
IPR015880 | 323 | 345 | SM00355 | Zinc finger | |
IPR015880 | 351 | 373 | SM00355 | Zinc finger | |
IPR015880 | 379 | 401 | SM00355 | Zinc finger | |
IPR015880 | 407 | 429 | SM00355 | Zinc finger | |
IPR015880 | 435 | 457 | SM00355 | Zinc finger | |
IPR015880 | 463 | 485 | SM00355 | Zinc finger | |
IPR015880 | 491 | 513 | SM00355 | Zinc finger | |
IPR015880 | 519 | 541 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 17 | 89 | PS50805 | KRAB box |
IPR007087 | 183 | 210 | PS50157 | Zinc finger | |
IPR007087 | 211 | 238 | PS50157 | Zinc finger | |
IPR007087 | 239 | 266 | PS50157 | Zinc finger | |
IPR007087 | 267 | 294 | PS50157 | Zinc finger | |
IPR007087 | 295 | 322 | PS50157 | Zinc finger | |
IPR007087 | 323 | 350 | PS50157 | Zinc finger | |
IPR007087 | 351 | 378 | PS50157 | Zinc finger | |
IPR007087 | 379 | 406 | PS50157 | Zinc finger | |
IPR007087 | 407 | 434 | PS50157 | Zinc finger | |
IPR007087 | 435 | 462 | PS50157 | Zinc finger | |
IPR007087 | 463 | 490 | PS50157 | Zinc finger | |
IPR007087 | 491 | 518 | PS50157 | Zinc finger | |
IPR007087 | 519 | 544 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 185 | 205 | PS00028 | Zinc finger |
IPR007087 | 213 | 233 | PS00028 | Zinc finger | |
IPR007087 | 241 | 261 | PS00028 | Zinc finger | |
IPR007087 | 269 | 289 | PS00028 | Zinc finger | |
IPR007087 | 297 | 317 | PS00028 | Zinc finger | |
IPR007087 | 325 | 345 | PS00028 | Zinc finger | |
IPR007087 | 353 | 373 | PS00028 | Zinc finger | |
IPR007087 | 381 | 401 | PS00028 | Zinc finger | |
IPR007087 | 409 | 429 | PS00028 | Zinc finger | |
IPR007087 | 437 | 457 | PS00028 | Zinc finger | |
IPR007087 | 465 | 485 | PS00028 | Zinc finger | |
IPR007087 | 493 | 513 | PS00028 | Zinc finger | |
IPR007087 | 521 | 541 | PS00028 | Zinc finger |
![]() |
Primer_f | GTAGAAATGCCTCCTGTCACC |
---|---|
Primer_r | TCCCTCTAATTCTTCAACAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |