Gene/Protein Characteristic Table for KIAA1559
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00863
Accession No AB046779
Description ZFP14 zinc finger protein, transcript variant 2
Clone name fh19195
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5659 bp)
Predicted protein sequence (544 aa)
Flexi ORF Clone FXC00863
Source Human fetal brain
Rouge ID mKIAA1559 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5659 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 3964 bp
Genome contig ID gi42406306r_41419281
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
GCACTCCAGCCTGGGTAACAGAGCAAGAGTCTGTC
Flanking genome sequence
(99721 - 99672)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGGAACAGCCAAGTAACAGTAGAAAGTAGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 41519002 41550715 4 99.1 Terminal No-hit
Features of the protein sequence
Description

Length: 544 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_512623 0 99.1 zinc finger pro...
 Pan troglodytes
Q9HCL3 0 100.0 Zinc finger pro...
 Homo sapiens
BAF85792 0 99.6 unnamed protein...
 Homo sapiens
XP_001790692 4.3e-207 90.7 similar to zinc...
 Bos taurus
XP_001494637 6e-195 91.5 similar to zinc...
 Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB075828 4.1e-101 70.6 KIAA1948
AB023178 7.9e-92 69.4 KIAA0961
AB040906 1.5e-78 50.3 KIAA1473
AB046831 1.4e-71 45.7 KIAA1611
AB058730 3.8e-69 54.0 KIAA1827
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 183 206 PD000003 Zinc finger
IPR007087 211 234 PD000003 Zinc finger
IPR007087 239 262 PD000003 Zinc finger
IPR007087 267 290 PD000003 Zinc finger
IPR007087 295 318 PD000003 Zinc finger
IPR007087 323 345 PD000003 Zinc finger
IPR007087 351 374 PD000003 Zinc finger
IPR007087 379 402 PD000003 Zinc finger
IPR007087 407 429 PD000003 Zinc finger
IPR007087 435 458 PD000003 Zinc finger
IPR007087 463 486 PD000003 Zinc finger
IPR007087 491 514 PD000003 Zinc finger
IPR007087 519 542 PD000003 Zinc finger
HMMPfam IPR001909 17 57 PF01352 KRAB box
IPR007087 183 205 PF00096 Zinc finger
IPR007087 211 233 PF00096 Zinc finger
IPR007087 239 261 PF00096 Zinc finger
IPR007087 267 289 PF00096 Zinc finger
IPR007087 295 317 PF00096 Zinc finger
IPR007087 323 345 PF00096 Zinc finger
IPR007087 351 373 PF00096 Zinc finger
IPR007087 379 401 PF00096 Zinc finger
IPR007087 407 429 PF00096 Zinc finger
IPR007087 435 457 PF00096 Zinc finger
IPR007087 463 485 PF00096 Zinc finger
IPR007087 491 513 PF00096 Zinc finger
IPR007087 519 541 PF00096 Zinc finger
HMMSmart IPR001909 17 78 SM00349 KRAB box
IPR015880 183 205 SM00355 Zinc finger
IPR015880 211 233 SM00355 Zinc finger
IPR015880 239 261 SM00355 Zinc finger
IPR015880 267 289 SM00355 Zinc finger
IPR015880 295 317 SM00355 Zinc finger
IPR015880 323 345 SM00355 Zinc finger
IPR015880 351 373 SM00355 Zinc finger
IPR015880 379 401 SM00355 Zinc finger
IPR015880 407 429 SM00355 Zinc finger
IPR015880 435 457 SM00355 Zinc finger
IPR015880 463 485 SM00355 Zinc finger
IPR015880 491 513 SM00355 Zinc finger
IPR015880 519 541 SM00355 Zinc finger
ProfileScan IPR001909 17 89 PS50805 KRAB box
IPR007087 183 210 PS50157 Zinc finger
IPR007087 211 238 PS50157 Zinc finger
IPR007087 239 266 PS50157 Zinc finger
IPR007087 267 294 PS50157 Zinc finger
IPR007087 295 322 PS50157 Zinc finger
IPR007087 323 350 PS50157 Zinc finger
IPR007087 351 378 PS50157 Zinc finger
IPR007087 379 406 PS50157 Zinc finger
IPR007087 407 434 PS50157 Zinc finger
IPR007087 435 462 PS50157 Zinc finger
IPR007087 463 490 PS50157 Zinc finger
IPR007087 491 518 PS50157 Zinc finger
IPR007087 519 544 PS50157 Zinc finger
ScanRegExp IPR007087 185 205 PS00028 Zinc finger
IPR007087 213 233 PS00028 Zinc finger
IPR007087 241 261 PS00028 Zinc finger
IPR007087 269 289 PS00028 Zinc finger
IPR007087 297 317 PS00028 Zinc finger
IPR007087 325 345 PS00028 Zinc finger
IPR007087 353 373 PS00028 Zinc finger
IPR007087 381 401 PS00028 Zinc finger
IPR007087 409 429 PS00028 Zinc finger
IPR007087 437 457 PS00028 Zinc finger
IPR007087 465 485 PS00028 Zinc finger
IPR007087 493 513 PS00028 Zinc finger
IPR007087 521 541 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTAGAAATGCCTCCTGTCACC
Primer_r TCCCTCTAATTCTTCAACAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp