Gene/Protein Characteristic Table for KIAA0961
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00698
Accession No AB023178
Description ZFP30 zinc finger protein
Clone name hj05830
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4612 bp)
Predicted protein sequence (530 aa)
Flexi ORF Clone FXC00698
Source Human adult brain
Rouge ID mKIAA0961 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4612 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2494 bp
Genome contig ID gi42406306r_42715546
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
TCAGCGCTGGCATAAACAATAAAAAGTAGACTTGG
Flanking genome sequence
(222608 - 222559)		 
----+----*----+----*----+----*----+----*----+----*
CTTCAGTATTTAAGGCCATAGATTTTGCTTTGAGCACAGATTTTGCTGTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 42809130 42838153 7 98.1 Terminal No-hit
Features of the protein sequence
Description

Length: 530 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y2G7 0 100.0 Zinc finger pro...
 Homo sapiens
XP_001165619 0 99.8 zinc finger pro...
 Pan troglodytes
XP_001165552 0 99.6 zinc finger pro...
 Pan troglodytes
Q9BE27 0 98.1 Zinc finger pro...
 Macaca fascicularis
XP_001493771 2.6e-196 86.0 similar to zinc...
 Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB075828 8.4e-98 76.8 KIAA1948
AB046779 1.2e-86 69.4 KIAA1559
AB046831 7.4e-66 44.6 KIAA1611
AB037770 3.1e-65 56.1 KIAA1349
D31763 6.3e-64 53.8 KIAA0065
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 169 192 PD000003 Zinc finger
IPR007087 197 220 PD000003 Zinc finger
IPR007087 225 247 PD000003 Zinc finger
IPR007087 253 276 PD000003 Zinc finger
IPR007087 281 301 PD000003 Zinc finger
IPR007087 309 332 PD000003 Zinc finger
IPR007087 337 360 PD000003 Zinc finger
IPR007087 365 388 PD000003 Zinc finger
IPR007087 393 415 PD000003 Zinc finger
IPR007087 421 443 PD000003 Zinc finger
IPR007087 449 472 PD000003 Zinc finger
IPR007087 477 500 PD000003 Zinc finger
IPR007087 505 527 PD000003 Zinc finger
HMMPfam IPR001909 17 57 PF01352 KRAB box
IPR007087 169 191 PF00096 Zinc finger
IPR007087 197 219 PF00096 Zinc finger
IPR007087 225 247 PF00096 Zinc finger
IPR007087 253 275 PF00096 Zinc finger
IPR007087 281 308 PF00096 Zinc finger
IPR007087 337 359 PF00096 Zinc finger
IPR007087 365 387 PF00096 Zinc finger
IPR007087 393 415 PF00096 Zinc finger
IPR007087 421 443 PF00096 Zinc finger
IPR007087 449 471 PF00096 Zinc finger
IPR007087 477 499 PF00096 Zinc finger
IPR007087 505 527 PF00096 Zinc finger
HMMSmart IPR001909 17 78 SM00349 KRAB box
IPR015880 169 191 SM00355 Zinc finger
IPR015880 197 219 SM00355 Zinc finger
IPR015880 225 247 SM00355 Zinc finger
IPR015880 253 275 SM00355 Zinc finger
IPR015880 281 301 SM00355 Zinc finger
IPR015880 309 331 SM00355 Zinc finger
IPR015880 337 359 SM00355 Zinc finger
IPR015880 365 387 SM00355 Zinc finger
IPR015880 393 415 SM00355 Zinc finger
IPR015880 421 443 SM00355 Zinc finger
IPR015880 449 471 SM00355 Zinc finger
IPR015880 477 499 SM00355 Zinc finger
IPR015880 505 527 SM00355 Zinc finger
ProfileScan IPR001909 17 89 PS50805 KRAB box
IPR007087 169 196 PS50157 Zinc finger
IPR007087 197 224 PS50157 Zinc finger
IPR007087 225 252 PS50157 Zinc finger
IPR007087 253 280 PS50157 Zinc finger
IPR007087 281 308 PS50157 Zinc finger
IPR007087 309 336 PS50157 Zinc finger
IPR007087 337 364 PS50157 Zinc finger
IPR007087 365 392 PS50157 Zinc finger
IPR007087 393 420 PS50157 Zinc finger
IPR007087 421 448 PS50157 Zinc finger
IPR007087 449 476 PS50157 Zinc finger
IPR007087 477 504 PS50157 Zinc finger
IPR007087 505 530 PS50157 Zinc finger
ScanRegExp IPR007087 171 191 PS00028 Zinc finger
IPR007087 199 219 PS00028 Zinc finger
IPR007087 227 247 PS00028 Zinc finger
IPR007087 255 275 PS00028 Zinc finger
IPR007087 311 331 PS00028 Zinc finger
IPR007087 339 359 PS00028 Zinc finger
IPR007087 367 387 PS00028 Zinc finger
IPR007087 395 415 PS00028 Zinc finger
IPR007087 423 443 PS00028 Zinc finger
IPR007087 451 471 PS00028 Zinc finger
IPR007087 479 499 PS00028 Zinc finger
IPR007087 507 527 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCCCTTTTGCTTCATGCTCAC
Primer_r CACAGATGGAAGAATATGGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f TCCCTTTTGCTTCATGCTCAC
Primer_r CACAGATGGAAGAATATGGAG
PCR product length 206 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp