Gene/Protein Characteristic Table for KIAA1948
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07494
Accession No AB075828
Description ZFP82 zinc finger protein
Clone name fh24556
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5718 bp)
Predicted protein sequence (487 aa)
Source Human fetal brain
Rouge ID mKIAA1948 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5718 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2391 bp
Genome contig ID gi42406306r_41473233
PolyA signal sequence
(AATACA,-10)		 
+----*----+----*----+----*----+----
GAAGTAATGGCCTAGTTTTTTAACCAATACATGTC
Flanking genome sequence
(99859 - 99810)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGACAAAAATGGAATCCTACACTTTAAAGGAGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 41573092 41578809 1 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 487 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8N141 4.7e-200 100.0 Zinc finger pro...
 Homo sapiens
BAC11308 3.7e-199 99.6 unnamed protein...
 Homo sapiens
XP_001112876 1.6e-197 98.7 similar to zinc...
 Macaca mulatta
XP_001494637 1.5e-186 93.8 similar to zinc...
 Equus caballus
XP_001788291 1.3e-183 91.2 similar to zinc...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023178 6.5e-109 76.8 KIAA0961
AB046779 2.7e-106 70.6 KIAA1559
AB046831 2.3e-72 56.0 KIAA1611
AB037770 1e-70 55.9 KIAA1349
D31763 1.7e-70 56.2 KIAA0065
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 125 148 PD000003 Zinc finger
IPR007087 153 176 PD000003 Zinc finger
IPR007087 181 203 PD000003 Zinc finger
IPR007087 209 232 PD000003 Zinc finger
IPR007087 237 257 PD000003 Zinc finger
IPR007087 265 288 PD000003 Zinc finger
IPR007087 293 316 PD000003 Zinc finger
IPR007087 321 344 PD000003 Zinc finger
IPR007087 349 371 PD000003 Zinc finger
IPR007087 377 399 PD000003 Zinc finger
IPR007087 405 428 PD000003 Zinc finger
IPR007087 433 456 PD000003 Zinc finger
IPR007087 461 483 PD000003 Zinc finger
HMMPfam IPR007087 125 147 PF00096 Zinc finger
IPR007087 153 175 PF00096 Zinc finger
IPR007087 181 203 PF00096 Zinc finger
IPR007087 209 231 PF00096 Zinc finger
IPR007087 237 259 PF00096 Zinc finger
IPR007087 293 315 PF00096 Zinc finger
IPR007087 321 343 PF00096 Zinc finger
IPR007087 349 371 PF00096 Zinc finger
IPR007087 377 399 PF00096 Zinc finger
IPR007087 405 427 PF00096 Zinc finger
IPR007087 433 455 PF00096 Zinc finger
IPR007087 461 483 PF00096 Zinc finger
HMMSmart IPR015880 125 147 SM00355 Zinc finger
IPR015880 153 175 SM00355 Zinc finger
IPR015880 181 203 SM00355 Zinc finger
IPR015880 209 231 SM00355 Zinc finger
IPR015880 237 257 SM00355 Zinc finger
IPR015880 265 287 SM00355 Zinc finger
IPR015880 293 315 SM00355 Zinc finger
IPR015880 321 343 SM00355 Zinc finger
IPR015880 349 371 SM00355 Zinc finger
IPR015880 377 399 SM00355 Zinc finger
IPR015880 405 427 SM00355 Zinc finger
IPR015880 433 455 SM00355 Zinc finger
IPR015880 461 483 SM00355 Zinc finger
ProfileScan IPR007087 125 152 PS50157 Zinc finger
IPR007087 153 180 PS50157 Zinc finger
IPR007087 181 208 PS50157 Zinc finger
IPR007087 209 236 PS50157 Zinc finger
IPR007087 237 264 PS50157 Zinc finger
IPR007087 265 292 PS50157 Zinc finger
IPR007087 293 320 PS50157 Zinc finger
IPR007087 321 348 PS50157 Zinc finger
IPR007087 349 376 PS50157 Zinc finger
IPR007087 377 404 PS50157 Zinc finger
IPR007087 405 432 PS50157 Zinc finger
IPR007087 433 460 PS50157 Zinc finger
IPR007087 461 487 PS50157 Zinc finger
ScanRegExp IPR007087 127 147 PS00028 Zinc finger
IPR007087 155 175 PS00028 Zinc finger
IPR007087 183 203 PS00028 Zinc finger
IPR007087 211 231 PS00028 Zinc finger
IPR007087 267 287 PS00028 Zinc finger
IPR007087 295 315 PS00028 Zinc finger
IPR007087 323 343 PS00028 Zinc finger
IPR007087 351 371 PS00028 Zinc finger
IPR007087 379 399 PS00028 Zinc finger
IPR007087 407 427 PS00028 Zinc finger
IPR007087 435 455 PS00028 Zinc finger
IPR007087 463 483 PS00028 Zinc finger

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 1 GLLLLSFISTLEMLLLLVKENSM 23 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTATGTGAAGGGGCAAATGGG
Primer_r TGTATCTCTCTGCCTCTAGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp