KIAA0789

Product ID	ORK00639
Accession No	AB018332
Description	WSC domain containing 2, transcript variant 1
Clone name	pj01253
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4217 bp) Predicted protein sequence (620 aa)
HaloTag ORF Clone	FHC00639
Flexi ORF Clone	FXC00639
Source	Human brain (hippocampus)
Rouge ID	mKIAA0789 by Kazusa Mouse cDNA Project
Note	We replaced hk05559, former representative clones for KIAA0789 with pj01253. (2001/5/29)

Length: 4217 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1775 bp
Genome contig ID	gi89161190f_106947641
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- CACCATCATTAAATGCGAGTTTTGTTGATGATTCT
Flanking genome sequence (220386 - 220435)	----+--------+--------+--------+--------+----* ACCATGTGGTAGAGTGTTGTGTAAGACAGGTTCACAAATGGGATGTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	107047641	107168025	9	99.5	Perfect prediction

Length: 620 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI10331	99.8	WSCD2 protein [...	Homo sapiens
BAG57182	99.6	unnamed protein...	Homo sapiens
XP_543448	95.6	similar to CG91...	Canis lupus fam...
EDL19945	91.6	RIKEN cDNA C530...	Mus musculus
EDM13973	91.3	rCG21835, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011095	5.6e-108	56.4	KIAA0523

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002889	185	264	PF01822	Carbohydrate-binding WSC
HMMPfam	IPR002889	288	369	PF01822	Carbohydrate-binding WSC
HMMSmart	IPR013994	182	274	SM00321	Carbohydrate-binding WSC
HMMSmart	IPR013994	285	379	SM00321	Carbohydrate-binding WSC
ProfileScan	IPR002889	182	274	PS51212	Carbohydrate-binding WSC
ProfileScan	IPR002889	285	379	PS51212	Carbohydrate-binding WSC

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	72	VRFFTFLALYLTAGSLVFLHSGF	94	PRIMARY	23

Primer_f	GAAGTGCTGGTTAGTCTGTGC
Primer_r	AAGCCATTCATGATCACAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAAGTGCTGGTTAGTCTGTGC
Primer_r	AAGCCATTCATGATCACAGGG
PCR product length	92 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles