KIAA0523

Product ID	ORK07371
Accession No	AB011095
Description	WSC domain containing 1
Clone name	hg01394
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5172 bp) Predicted protein sequence (468 aa)
Source	Human adult brain
Rouge ID	mKIAA0523 by Kazusa Mouse cDNA Project

Length: 5172 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3765 bp
Genome contig ID	gi51511734f_5825024
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTGTTATATGAGCTAATAAATTCTGTTTATTGTTT
Flanking genome sequence (143447 - 143496)	----+--------+--------+--------+--------+----* AAGTTGGGTTGAGTTTAATTTCTGTTACTTATAACTCAGAACATGGTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	5925024	5968469	8	99.1	Perfect prediction

Length: 468 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH09975	0	99.8	WSCD1 protein [...	Homo sapiens
XP_001101952	0	98.1	similar to CG91...	Macaca mulatta
XP_001918396	3.9e-206	90.6	WSC domain cont...	Equus caballus
XP_848808	7.5e-201	89.1	similar to CG91...	Canis lupus fam...
Q80XH4	2.8e-196	87.9	WSC domain-cont...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018332	1.3e-120	56.5	KIAA0789

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002889	38	117	PF01822	Carbohydrate-binding WSC
HMMPfam	IPR002889	141	223	PF01822	Carbohydrate-binding WSC
HMMSmart	IPR013994	35	127	SM00321	Carbohydrate-binding WSC
HMMSmart	IPR013994	138	233	SM00321	Carbohydrate-binding WSC
ProfileScan	IPR002889	35	127	PS51212	Carbohydrate-binding WSC
ProfileScan	IPR002889	138	233	PS51212	Carbohydrate-binding WSC

Primer_f	CCCTTCAGTGGTGTCAGCTTC
Primer_r	AAGACTTATGGGAATGCTGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCTTCAGTGGTGTCAGCTTC
Primer_r	AAGACTTATGGGAATGCTGGG
PCR product length	146 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles