Gene/Protein Characteristic Table for KIAA0794
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00641
Accession No AB018337
Description UBX domain protein 7
Clone name hk06006
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4656 bp)
Predicted protein sequence (490 aa)
Flexi ORF Clone FXC00641
Source Human adult brain
Rouge ID mKIAA0794 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4656 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 3183 bp
Genome contig ID gi89161205r_197465055
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCCTGGGCGACAAAGCGACACTCCATCTCAAATTT
Flanking genome sequence
(99713 - 99664)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAGAAGAAGAAGAAGAAAACTAGTGGGAAAAAAGTGAGAG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 3 r 197564768 197643670 11 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 490 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O94888 3.1e-198 100.0 UBX domain-cont...
Homo sapiens
CAH89670 1.2e-197 99.8 hypothetical pr...
Pongo abelii
CAH90918 1.2e-197 99.8 hypothetical pr...
Pongo abelii
XP_545151 9.3e-196 98.4 similar to CG88...
Canis lupus fam...
XP_001499653 1.7e-195 98.2 similar to mCG1...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001012 408 488 PF00789 UBX
HMMSmart IPR006577 138 261 SM00594 UAS
IPR001012 406 488 SM00166 UBX
ProfileScan IPR001012 409 486 PS50033 UBX
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CATGGGAAGAGTTACGGATTG
Primer_r GGCAAACTGGAAGAAGCATAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp