KIAA0808

Product ID	ORK00132
Accession No	AB018351
Description	thymocyte selection-associated high mobility group box
Clone name	hk04477s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4133 bp) Predicted protein sequence (530 aa)
HaloTag ORF Clone	FHC00132
Flexi ORF Clone	FXC00132
Source	Human adult brain
Note	We replaced hk04477, former representative clones for KIAA0808 with hk04477s1. (2002/5/10)

Length: 4133 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2329 bp
Genome contig ID	gi51511724r_59780531
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAAACACATCATCAATAAAACTGTTATTATGCGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCGTATTCTATTTGGTGATCCATCAGTCTCTAAAAAGCAAGCCTAGTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	59880531	60194321	9	99.3	Perfect prediction

Length: 530 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94900	7.6e-175	100.0	Thymocyte selec...	Homo sapiens
XP_001088869	1.4e-174	99.8	similar to thym...	Macaca mulatta
AAH16665	3.4e-174	99.8	Thymocyte selec...	Homo sapiens
AAI47900	8.7e-167	95.4	TOX protein [Bo...	Bos taurus
XP_001928498	1.4e-165	95.3	similar to thym...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018280	2.1e-23	36.3	KIAA0737

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000135	280	298	PR00886	High mobility group box HMG1 and HMG2
	IPR000135	298	317	PR00886	High mobility group box HMG1 and HMG2
	IPR000135	317	337	PR00886	High mobility group box HMG1 and HMG2
HMMPfam	IPR000910	265	333	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR000910	264	334	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR000910	265	333	PS50118	HMG1/2 (high mobility group) box

Primer_f	TTACTGGGAGGAGAATGAGCA
Primer_r	TCAACACTCTCTACCCTGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-