Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07289 |
---|---|
Accession No | AB018353 |
Description | Sad1 and UNC84 domain containing 1 |
Clone name | hk05647s1 |
Vector information | |
cDNA sequence | DNA sequence (4047 bp) Predicted protein sequence (824 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0810
by Kazusa Mouse cDNA Project
|
Note | We replaced hk05647, former representative clones for KIAA0810 with hk05647s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1571 bp |
---|---|
Genome contig ID | gi89161213f_738664 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (142403 - 142452) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 838657 | 881065 | 21 | 99.7 | Terminal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 252 | WHIWACAGYFLLQILRRIGAVGQ | 274 | SECONDARY | 23 | 2 | 282 | SALWLAVVAPGKAASGVFWWLGI | 304 | PRIMARY | 23 | 3 | 317 | NVFLLTRCLRNICKFLVLLIPLF | 339 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GCAGCAGAAGCACTACCAAAG |
---|---|
Primer_r | ACTGATTTGGGATTTGGGGTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCAGCAGAAGCACTACCAAAG |
Primer_r | ACTGATTTGGGATTTGGGGTG |
PCR product length | 130 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |